ID: 991213905

View in Genome Browser
Species Human (GRCh38)
Location 5:64138858-64138880
Sequence TGAAGGCCAAGGACAAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991213902_991213905 4 Left 991213902 5:64138831-64138853 CCACACTGAGGTACATACTCAAA No data
Right 991213905 5:64138858-64138880 TGAAGGCCAAGGACAAAGACAGG No data
991213901_991213905 5 Left 991213901 5:64138830-64138852 CCCACACTGAGGTACATACTCAA No data
Right 991213905 5:64138858-64138880 TGAAGGCCAAGGACAAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991213905 Original CRISPR TGAAGGCCAAGGACAAAGAC AGG Intergenic