ID: 991216887

View in Genome Browser
Species Human (GRCh38)
Location 5:64165961-64165983
Sequence CCCGCCCGACTCCGACCCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 135}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991216887_991216900 20 Left 991216887 5:64165961-64165983 CCGGCGGGTCGGAGTCGGGCGGG 0: 1
1: 0
2: 0
3: 12
4: 135
Right 991216900 5:64166004-64166026 GGAGGGACCTGGCCTCGGCCGGG 0: 1
1: 0
2: 4
3: 28
4: 296
991216887_991216893 -1 Left 991216887 5:64165961-64165983 CCGGCGGGTCGGAGTCGGGCGGG 0: 1
1: 0
2: 0
3: 12
4: 135
Right 991216893 5:64165983-64166005 GGCGCGGCGGCGGCGCCTCTCGG 0: 1
1: 0
2: 3
3: 24
4: 308
991216887_991216895 3 Left 991216887 5:64165961-64165983 CCGGCGGGTCGGAGTCGGGCGGG 0: 1
1: 0
2: 0
3: 12
4: 135
Right 991216895 5:64165987-64166009 CGGCGGCGGCGCCTCTCGGAGGG 0: 1
1: 0
2: 1
3: 13
4: 133
991216887_991216896 9 Left 991216887 5:64165961-64165983 CCGGCGGGTCGGAGTCGGGCGGG 0: 1
1: 0
2: 0
3: 12
4: 135
Right 991216896 5:64165993-64166015 CGGCGCCTCTCGGAGGGACCTGG 0: 1
1: 0
2: 0
3: 7
4: 81
991216887_991216894 2 Left 991216887 5:64165961-64165983 CCGGCGGGTCGGAGTCGGGCGGG 0: 1
1: 0
2: 0
3: 12
4: 135
Right 991216894 5:64165986-64166008 GCGGCGGCGGCGCCTCTCGGAGG 0: 1
1: 0
2: 6
3: 41
4: 297
991216887_991216899 19 Left 991216887 5:64165961-64165983 CCGGCGGGTCGGAGTCGGGCGGG 0: 1
1: 0
2: 0
3: 12
4: 135
Right 991216899 5:64166003-64166025 CGGAGGGACCTGGCCTCGGCCGG 0: 1
1: 0
2: 1
3: 13
4: 173
991216887_991216898 15 Left 991216887 5:64165961-64165983 CCGGCGGGTCGGAGTCGGGCGGG 0: 1
1: 0
2: 0
3: 12
4: 135
Right 991216898 5:64165999-64166021 CTCTCGGAGGGACCTGGCCTCGG 0: 1
1: 0
2: 3
3: 24
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991216887 Original CRISPR CCCGCCCGACTCCGACCCGC CGG (reversed) Intronic
900119095 1:1041017-1041039 CCCGCCCCGCTCCGCCCCCCAGG - Intronic
900119133 1:1041092-1041114 CCCGCCCCGCTCCGCCCCCCAGG - Intronic
900344477 1:2204585-2204607 CCCGCCCGCCGCCGAGCCCCCGG + Intronic
901396639 1:8986788-8986810 CCCGCCCAACCCTGACCTGCAGG - Intergenic
902409994 1:16206907-16206929 CCGGCCCGCCCCCGCCCCGCCGG + Intronic
903501257 1:23801095-23801117 TCCGCCCCACTCTGACCCGCAGG + Intergenic
903925481 1:26827857-26827879 CCCGCCCGCCTCCACCCAGCCGG + Intronic
906525205 1:46489704-46489726 CCCGCCCTGCCCCGCCCCGCTGG - Intergenic
908477764 1:64505856-64505878 CCCGCCCCGCCCCGCCCCGCCGG + Intronic
916694409 1:167221385-167221407 CGCGCCCTACTGCGCCCCGCCGG - Intronic
917974433 1:180230012-180230034 CCCGCCCCCCTCCGCCCCGCCGG + Intergenic
921010237 1:211133950-211133972 CCCGCCGGACCCCGAGCTGCTGG - Exonic
924524675 1:244835588-244835610 CCCGCCCTGTTCCGACGCGCCGG - Exonic
1062843904 10:690039-690061 CCCGCCCCGCCCCGCCCCGCGGG - Intergenic
1062857370 10:785978-786000 CCCGCCCGGCTCCATCCTGCAGG - Intergenic
1063357265 10:5412796-5412818 CCCGTCCAGCTCCGACCCGGAGG - Exonic
1072027609 10:91476887-91476909 CGCGCCCGGCCCGGACCCGCAGG - Intronic
1073432159 10:103493884-103493906 CCCGCTCCACGCAGACCCGCGGG + Intergenic
1074182924 10:111078893-111078915 GCCGCGCGACACCGACGCGCTGG + Exonic
1075875637 10:125803673-125803695 CCAGCCTGAGTCTGACCCGCAGG + Intronic
1076356740 10:129858692-129858714 CCCTCCCTAATCCGACCCCCTGG + Intronic
1076880407 10:133236898-133236920 CGCGCCCCACGCCGACGCGCAGG + Intergenic
1077229047 11:1450527-1450549 CCCCCCCGGCCCCCACCCGCCGG + Intronic
1078180285 11:9004700-9004722 CCCGCCCCACGCCCACCCGCGGG - Intergenic
1078699616 11:13668466-13668488 CCCGCCCCACTCCCGCCCGGAGG + Intergenic
1078840312 11:15071837-15071859 CCCGCCCTAGTCCCACCAGCTGG + Intronic
1083997120 11:66278162-66278184 CGCCCCCGGCTCCGCCCCGCCGG + Intergenic
1087076211 11:94129089-94129111 CCCGCCCCGCCCCGCCCCGCCGG + Exonic
1087672865 11:101127960-101127982 CCCGCCCGACGCCGAGCCCAAGG - Exonic
1090385543 11:126355871-126355893 CCCGCCCCGCCCCGCCCCGCGGG - Intronic
1096178377 12:49538037-49538059 CGGGCCCGGCTCCGCCCCGCCGG + Intergenic
1103718459 12:122960236-122960258 CCCGCCCACCTCCAACCAGCAGG - Exonic
1103798797 12:123523696-123523718 CCCCACCCACTCCGACCCTCAGG + Intronic
1105353086 13:19633537-19633559 CCCGCCCACCTGCGTCCCGCGGG + Intergenic
1113480368 13:110615863-110615885 CTCTCCCTACTCCGCCCCGCAGG - Intronic
1113767986 13:112892819-112892841 CGGGCCCCACTCAGACCCGCAGG - Intergenic
1120914814 14:89701701-89701723 CCCGCCCCGCCCCGCCCCGCTGG - Intergenic
1122286307 14:100654833-100654855 CCCGCCCGACCCTGCCCCCCGGG + Intergenic
1122904488 14:104795555-104795577 CCCGCCCAGCGCCGGCCCGCGGG - Intronic
1122975364 14:105168662-105168684 CCGGCCCGGCTCCCACCCGGCGG + Exonic
1125535895 15:40441119-40441141 CCCGCCCGGCCCCGGCCCCCAGG + Intronic
1130955000 15:88621403-88621425 CCCGCCCGACCCCGCCGCCCCGG - Intronic
1131735489 15:95327014-95327036 CCGGCCCGGGTCCGAGCCGCGGG + Intergenic
1132480647 16:164841-164863 CCCGCCCCGCCCCGCCCCGCCGG - Intronic
1132902824 16:2267772-2267794 CCCGCGGGACTCAGACCAGCGGG - Intronic
1132947055 16:2537740-2537762 CCCGCCCAGCCCCGCCCCGCAGG + Intergenic
1136025956 16:27469290-27469312 CCCGCCCGGCTCAGGCCCGCTGG - Exonic
1141132150 16:81444387-81444409 CCCGTCCGAGTCCGGCCCGGGGG + Intergenic
1142509832 17:386265-386287 CCCGCCCCGCCCCGCCCCGCTGG + Intergenic
1144828949 17:18121270-18121292 CCAGCCCCACGCCGAGCCGCTGG + Exonic
1151408038 17:73902215-73902237 CCCGCCCCGCTCCGCCCTGCTGG + Intergenic
1152077495 17:78168539-78168561 CCCGCCCGACTCCACCCGCCGGG - Exonic
1152362670 17:79839718-79839740 TCCGCCCGCCTCCGCCCCGGCGG - Intergenic
1152572815 17:81127986-81128008 CCCGCCCCACGCCGGCCCCCAGG + Intronic
1152613980 17:81329587-81329609 CCAGCCCAGCTCCTACCCGCCGG + Intronic
1157384775 18:47251464-47251486 CCCGCCAGAGTCCCGCCCGCTGG - Intergenic
1157529324 18:48408760-48408782 CCCGCCCCGCTCGGGCCCGCAGG + Intronic
1160961880 19:1725777-1725799 CCCGCCCGACCCCGCCCCCCCGG + Intergenic
1161088233 19:2344763-2344785 CCTGCCCGACTCTGACCCTCAGG - Intronic
1161400609 19:4065247-4065269 GCCGTCCGGCTCCGACCCGCGGG - Intronic
1161471220 19:4457564-4457586 CCCGGCCGTCCCCGCCCCGCAGG + Intronic
1164700436 19:30280738-30280760 CCTGCCCGACTCAGACCCATGGG - Intronic
1165156560 19:33792346-33792368 CCCGCCCCACTCCCACCCCCAGG + Intergenic
1165311418 19:35031055-35031077 CCAGCCCGGCCCCCACCCGCTGG - Intronic
1165445967 19:35856856-35856878 CCCGCCCGGGTCCGCCCCCCGGG - Intronic
1165831013 19:38730329-38730351 CACGCCCGACGCAGACCCGGAGG - Exonic
1168311273 19:55461974-55461996 ACCGCGCGACTCCGCCCCGTCGG - Intronic
1168495010 19:56840539-56840561 CCCGCGCGCCTCCTGCCCGCGGG - Intronic
927805607 2:26144022-26144044 CCAGCCCGAATCCCACCAGCAGG + Intergenic
928103329 2:28452223-28452245 CCCGCCCCACACCTACCCCCTGG + Intergenic
929188687 2:39120694-39120716 CCCGCCCCTCCCCGGCCCGCCGG + Intronic
934966878 2:98731172-98731194 CCCGCCCCGCCCCGCCCCGCCGG + Intergenic
937084001 2:119158676-119158698 CCCGCCAGGCTCCGCTCCGCTGG + Exonic
938380173 2:130832066-130832088 CCCGCCCCACCCTCACCCGCAGG - Intergenic
938536592 2:132253636-132253658 CCCTGCCGACTCCGTCCCCCCGG - Intronic
943589866 2:189784271-189784293 GCCGCCCCACTCCGGGCCGCCGG + Intronic
944413856 2:199464636-199464658 CTCGCCAGACCCCGGCCCGCTGG - Intronic
947399126 2:229714593-229714615 CCCGCCCCGCCCCGCCCCGCAGG - Intergenic
947919126 2:233854328-233854350 CCAGCCTCACTCCGACACGCAGG + Intronic
1172618698 20:36306387-36306409 CCGCCCCGGCTCCGGCCCGCGGG - Exonic
1172742405 20:37179320-37179342 CCCGCCGGAGTCCGAGCCGCGGG - Exonic
1174287797 20:49484330-49484352 CGCGCTCGCTTCCGACCCGCAGG - Intergenic
1175971880 20:62690465-62690487 CCCGCCCTCCACCGAGCCGCAGG + Intergenic
1176061703 20:63175502-63175524 CCCGCGCGGCTCCTACCGGCCGG + Intergenic
1176380639 21:6110823-6110845 CCCGCCCGCCTGCGCTCCGCCGG - Intergenic
1179742833 21:43427417-43427439 CCCGCCCGCCTGCGCTCCGCCGG + Intergenic
1179988284 21:44932856-44932878 CCCGCCGGGCTCCGACCGCCTGG + Intronic
1180005538 21:45018944-45018966 CCCGCCCCACCCCCACCCGTGGG + Intergenic
1184337401 22:43862036-43862058 CCCACCCCACCCCGCCCCGCAGG + Intronic
1184359773 22:44008224-44008246 CCCGCCCGCCTCCGAGTAGCTGG + Intronic
1184680708 22:46071116-46071138 CCCGCCCGCCTCGGCCGCGCGGG + Intronic
1184724601 22:46336115-46336137 CCCACCCCACCCCGGCCCGCCGG - Intronic
1185321170 22:50200846-50200868 CCCGGACGCCTCCGACCCTCCGG + Intergenic
1185398418 22:50604049-50604071 CTCGCCCGGCTCCGACTCGGAGG + Exonic
952287242 3:31981036-31981058 CCCGGCCGCCGCCGACCGGCTGG + Exonic
952816621 3:37452567-37452589 CCCGCCCGACTCCGCGACCCTGG + Intronic
954717540 3:52533928-52533950 CCCGCCCCGCCCCGCCCCGCCGG - Intronic
959078932 3:101779606-101779628 CCCGCCCCGCCCCGCCCCGCCGG - Intronic
961549757 3:127662320-127662342 CCAGCCAGGCTCCGAACCGCAGG + Intronic
961797719 3:129421682-129421704 TCCGCCTGCCTCAGACCCGCCGG - Exonic
968051552 3:195658234-195658256 CCCGCTCCGCTCGGACCCGCTGG - Intergenic
968104265 3:195990099-195990121 CCCGCTCCGCTCGGACCCGCTGG + Intergenic
968302566 3:197627689-197627711 CCCGCTCCGCTCGGACCCGCTGG + Intergenic
969213880 4:5708305-5708327 CCCGCCCCGCTCCGCCCCGGAGG + Exonic
970001361 4:11368913-11368935 CCCGCGGGACTCAGACCAGCGGG + Intergenic
973531814 4:51843287-51843309 GCCGCCCGGCCCCGGCCCGCTGG - Intronic
975585013 4:75940681-75940703 CGCGTTTGACTCCGACCCGCAGG + Intronic
981751092 4:148092818-148092840 CCCTCCCCACTCCGACCCCAGGG - Intronic
981782731 4:148445057-148445079 CCTGCCCGTTTCCCACCCGCGGG - Intergenic
982979640 4:162116507-162116529 GCCACCCAACTCCCACCCGCAGG + Intronic
985497620 5:218487-218509 CCCGCTCCGCTCGGACCCGCTGG - Intronic
991216887 5:64165961-64165983 CCCGCCCGACTCCGACCCGCCGG - Intronic
991587563 5:68215850-68215872 CCAGCCCGGCTGCGACCCGCCGG - Exonic
992365477 5:76084811-76084833 CCCGCCCCCCTCTGCCCCGCCGG - Intronic
1002610134 5:180412228-180412250 CCCGCCCCGCCCCGCCCCGCCGG - Intergenic
1004722171 6:18277318-18277340 CCCGCTCCCCTCCGCCCCGCGGG - Intergenic
1005584390 6:27261343-27261365 CCCCCCCCACTCCCCCCCGCGGG - Intergenic
1014632459 6:123803654-123803676 CCCGCCCCACCCCCGCCCGCCGG + Intergenic
1018393545 6:163359398-163359420 TCAGCCCGTCTCTGACCCGCCGG - Intergenic
1019343680 7:519805-519827 CCCGCCCAACTCCGGCGAGCCGG - Intronic
1023381158 7:39609810-39609832 CCCGCCCGGCTCCGGGCCCCAGG + Intronic
1027361654 7:77416135-77416157 CCCCCCGGACTCCGACCCGGTGG - Intronic
1028173627 7:87628511-87628533 AGCGCCTGACGCCGACCCGCAGG + Exonic
1028899052 7:96075677-96075699 TCGGCCCGGCTCAGACCCGCGGG - Intronic
1029123119 7:98281519-98281541 CCCTCCCGAAGCCGCCCCGCCGG - Intronic
1029275999 7:99404736-99404758 CCCGCCCGACCCCCACGTGCTGG + Intronic
1029692049 7:102188989-102189011 CCCGCAGGACTCAGACCAGCTGG + Intronic
1030033470 7:105388987-105389009 CCCGCCCCGCCCCCACCCGCCGG + Intronic
1034578895 7:152025797-152025819 ACAGCCCCAGTCCGACCCGCAGG - Intronic
1038522383 8:28244376-28244398 CCCGCCCCACCCCCACCCCCAGG + Intergenic
1039484405 8:37899622-37899644 CCCGCCCCGCCCCGCCCCGCCGG + Intergenic
1040559846 8:48514560-48514582 CCCGCCCGAGTCAGACACCCGGG - Intergenic
1040734784 8:50491883-50491905 CCCGCCCCCCTACCACCCGCAGG + Intronic
1045488627 8:102654217-102654239 CCCGCCCGCGCCCGACCCGGGGG + Intronic
1047753003 8:127896778-127896800 CCCCCCCGCCCCCGACCCACAGG + Intergenic
1049241160 8:141537998-141538020 CCCGCCAGGCTCTGACCTGCTGG - Intergenic
1049552602 8:143267415-143267437 CCCGCCCCACTCCGCCCGGCCGG - Exonic
1049620715 8:143597310-143597332 CGCGCCCGACTCCTTCCGGCGGG + Intronic
1049741141 8:144241585-144241607 CCTGCCCCACTCCAGCCCGCAGG - Intronic
1051896465 9:21994446-21994468 CCTGCCCATCTCCGCCCCGCAGG + Intronic
1059176649 9:112174904-112174926 CCCGCCCGACCCCGCGACGCCGG - Intronic
1060514637 9:124258122-124258144 CCCGCCCTTCTCCGGGCCGCGGG - Intronic
1060695738 9:125707313-125707335 CCCTCCCGGCCCCGCCCCGCGGG - Intergenic
1061839225 9:133347954-133347976 CCCGCCCTAGGCCGACCCGGCGG - Intronic
1062008852 9:134256319-134256341 CCTCCCCGACTCCCACCTGCAGG - Intergenic
1062696395 9:137878222-137878244 CCCGCCCGGCCCCGCCCGGCAGG - Intronic
1195269300 X:103215020-103215042 CCCGCCTGACTCCGGGCTGCAGG + Intergenic
1198051653 X:132957548-132957570 CCACCCCGACTCCTTCCCGCGGG + Intronic