ID: 991219085

View in Genome Browser
Species Human (GRCh38)
Location 5:64191469-64191491
Sequence GATACTTAGATATTAATACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991219074_991219085 25 Left 991219074 5:64191421-64191443 CCCTAAAATTCTCCTGCATTTCA 0: 1
1: 0
2: 1
3: 49
4: 403
Right 991219085 5:64191469-64191491 GATACTTAGATATTAATACAAGG No data
991219075_991219085 24 Left 991219075 5:64191422-64191444 CCTAAAATTCTCCTGCATTTCAC 0: 1
1: 0
2: 2
3: 25
4: 293
Right 991219085 5:64191469-64191491 GATACTTAGATATTAATACAAGG No data
991219077_991219085 2 Left 991219077 5:64191444-64191466 CCTATTCATCCTTCTCCTCCCCC 0: 1
1: 0
2: 19
3: 265
4: 2602
Right 991219085 5:64191469-64191491 GATACTTAGATATTAATACAAGG No data
991219078_991219085 -7 Left 991219078 5:64191453-64191475 CCTTCTCCTCCCCCCAGATACTT 0: 1
1: 0
2: 0
3: 38
4: 446
Right 991219085 5:64191469-64191491 GATACTTAGATATTAATACAAGG No data
991219076_991219085 13 Left 991219076 5:64191433-64191455 CCTGCATTTCACCTATTCATCCT 0: 1
1: 0
2: 6
3: 32
4: 321
Right 991219085 5:64191469-64191491 GATACTTAGATATTAATACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991219085 Original CRISPR GATACTTAGATATTAATACA AGG Intronic
No off target data available for this crispr