ID: 991221157

View in Genome Browser
Species Human (GRCh38)
Location 5:64219846-64219868
Sequence GTAGTTTCACTATGAAACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 197}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991221157_991221161 6 Left 991221157 5:64219846-64219868 CCAGTGTTTCATAGTGAAACTAC 0: 1
1: 0
2: 3
3: 13
4: 197
Right 991221161 5:64219875-64219897 CTGGAGATGTGTTTGTTGAAAGG 0: 1
1: 1
2: 4
3: 18
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991221157 Original CRISPR GTAGTTTCACTATGAAACAC TGG (reversed) Intronic
901040847 1:6362403-6362425 GGAGTTTCACTCTGTCACACAGG - Intronic
902036776 1:13463693-13463715 TGAGTTTCAATAGGAAACACGGG - Intergenic
902897927 1:19492061-19492083 GGAGTTTCACTATGTCACCCCGG - Intergenic
906169875 1:43715596-43715618 GTAGTCTCACTATGTTACCCAGG - Intronic
906399386 1:45493762-45493784 GGAGTTTCACTCTGTAACCCAGG - Intergenic
906685479 1:47760718-47760740 GTTGATTCACTGTGCAACACAGG - Exonic
906992905 1:50757941-50757963 GTAGTCTCACTCTGACACCCAGG + Intronic
908076482 1:60525140-60525162 GAAGTTTCACTATGTTACCCAGG + Intergenic
908858293 1:68453852-68453874 GTGGTTTCAGTGTGATACACCGG + Intergenic
909026758 1:70489996-70490018 GAAGTTTCACTATGTTACCCAGG + Intergenic
909127426 1:71691649-71691671 CTTTTTTCATTATGAAACACTGG + Intronic
910310818 1:85822614-85822636 GTAGTTTGACTATGTAACACAGG - Intronic
911354426 1:96798378-96798400 GGAGTTTCACTCTGTCACACAGG - Intronic
911562755 1:99426412-99426434 GTATTTTCAATCTGTAACACAGG + Intergenic
913242986 1:116846423-116846445 GAATTTTCACTAAGCAACACTGG + Intergenic
917550279 1:176019667-176019689 GTATTTTCACTATGTTACCCAGG - Intronic
917771430 1:178283888-178283910 GGATTTTCACTAAGAAACAATGG + Intronic
918327768 1:183426698-183426720 TTGGTTTCACCATGAAAAACAGG + Intergenic
920635071 1:207694414-207694436 GTATTTTCACTATGGATCAGTGG + Exonic
920636599 1:207710443-207710465 GTATTTTCACTATGGATCAGTGG + Intronic
924474772 1:244373300-244373322 GTAGTTTCACTATGTTGCCCAGG - Intronic
924783998 1:247177671-247177693 GCAACTTCACTATGAATCACAGG - Intergenic
1062816155 10:501951-501973 GGAGTTTCACTATGTTACCCAGG - Intronic
1064447460 10:15408278-15408300 ATAGTATCACTATGATACCCAGG + Intergenic
1065759115 10:28965293-28965315 CTAATTTCTCTGTGAAACACTGG - Intergenic
1067715099 10:48684863-48684885 GCCGTTTCACTCTGAATCACTGG - Intronic
1067797160 10:49328891-49328913 GTATTTTCACAATGAAAATCAGG - Intergenic
1069538369 10:69273239-69273261 GGAGTCTCACTCTGTAACACAGG + Intronic
1071754577 10:88522557-88522579 ATATTTTCAATAAGAAACACAGG + Intronic
1072275916 10:93823149-93823171 GGAGTTTCACTATGTTGCACAGG - Intergenic
1078416357 11:11169515-11169537 GTAGTCTCACTATCAGGCACAGG - Intergenic
1079785564 11:24667207-24667229 GGAGTCTCACTATGTCACACAGG + Intronic
1080313753 11:30925045-30925067 GGAGTTTCACTCTGATACCCAGG - Intronic
1085505737 11:77057816-77057838 ATAGTTTAACTTTGAAACAAAGG - Intergenic
1093232196 12:16559757-16559779 GGAGTTTCACTATGTTACCCAGG - Intronic
1093506510 12:19872845-19872867 GATTTTCCACTATGAAACACTGG + Intergenic
1097165933 12:57086996-57087018 GTAGTTTCACTCTCACACACGGG + Intronic
1097534413 12:60848255-60848277 GTAGTTTTATTATGAAAGAGAGG + Intergenic
1099157299 12:79194323-79194345 GTAGTTACATTATTAAACATAGG - Intronic
1102232374 12:111272488-111272510 GTAGTCTCACTCTGTCACACAGG + Intronic
1104849480 12:131864713-131864735 ATAGTTTTCCTGTGAAACACAGG + Intergenic
1107126589 13:36853257-36853279 GGAGTTTCACTCTGTCACACAGG - Intronic
1107224580 13:38032155-38032177 GTAGTTTTACAATGAACCAGTGG + Intergenic
1108400707 13:50039268-50039290 GTAGTTTCATTCAGAAAGACAGG - Intergenic
1108732010 13:53245193-53245215 GTAGTTTAAGGATGAAAAACTGG - Intergenic
1109728914 13:66384688-66384710 GGAGTTTCACTCTGACACTCAGG + Intronic
1110898182 13:80783846-80783868 GACATTTCAGTATGAAACACAGG - Intergenic
1112481552 13:99780737-99780759 GTAGTCTCACTATGTTGCACAGG + Intronic
1117741572 14:58824306-58824328 GGAGTTTCCCTAGGAAACCCTGG - Intergenic
1119823035 14:77635079-77635101 GTAGCTTTTCCATGAAACACAGG + Intergenic
1120401803 14:84041734-84041756 ATAGTTTAACTTTGAAACAAAGG - Intergenic
1126616101 15:50581986-50582008 GGAGTTTCACTCTGAAGCCCAGG + Intronic
1126946495 15:53827515-53827537 GGAGTTTCCCTAAGAGACACTGG - Intergenic
1127279985 15:57480701-57480723 TTAGTTTCATTCTGAAAGACGGG - Intronic
1127916956 15:63462672-63462694 GCAGTTTCACTATGTTACCCAGG - Intergenic
1133645503 16:7760685-7760707 GTATTTTCAGTATAGAACACGGG - Intergenic
1133915451 16:10105442-10105464 GTAGTTTCTCTATTAAACATTGG - Intronic
1135998426 16:27270848-27270870 ATAGTTTAACTTTGAAACAAAGG - Intronic
1136352417 16:29719630-29719652 GGAGTCTCACTATGTAACCCAGG + Intergenic
1137388400 16:48060879-48060901 TTAGTATTATTATGAAACACAGG - Intergenic
1139206139 16:65030752-65030774 GTAGTTTCACCATGTTGCACAGG + Intronic
1139565390 16:67772311-67772333 GTTGTGTCACTATGAACCACCGG + Intronic
1140497493 16:75402025-75402047 CTATATTCACTAGGAAACACTGG + Intronic
1140569361 16:76085321-76085343 GGAGTTTCACTATGTTACCCAGG + Intergenic
1141162157 16:81636553-81636575 GAAGTTTCACTCTGTAACCCAGG - Intronic
1143831719 17:9657472-9657494 GGAGTTTCACTATGTCACCCAGG - Intronic
1144860829 17:18300743-18300765 GGGGTTTCACTATGAAACCCAGG + Intronic
1156995035 18:43455095-43455117 GTTGTTATACTATGAAGCACAGG - Intergenic
1157043849 18:44072019-44072041 GGAGTTTCACTATGTCACCCAGG - Intergenic
1159743452 18:72201939-72201961 GTAATATTACTATGAAACAAAGG - Intergenic
1161691761 19:5739418-5739440 GAAGTATCACTATGACAGACAGG + Exonic
1162336340 19:10062852-10062874 GGAGTTTCACTATGTCACTCAGG - Intergenic
1162337070 19:10068323-10068345 GGAGTTTCACTATGCTACCCAGG - Intergenic
1163204588 19:15793453-15793475 GGAGTTTCACTATGTTACTCAGG + Intergenic
1164055618 19:21619764-21619786 GGAGTCTCACTCTGAAACCCAGG + Intergenic
1166836987 19:45673536-45673558 GGAGTTTCACTATGTTACCCAGG - Intronic
1167940763 19:52943965-52943987 GTAGTCTCACTATGTAACCCAGG - Intronic
927481824 2:23459942-23459964 GAAGTTTCACCATGAAGCAGAGG + Intronic
928870424 2:35970818-35970840 GTAGCTACTCTATGAAACACAGG + Intergenic
928939968 2:36717715-36717737 GTAGTTTCACAATGCTCCACAGG - Intronic
930419883 2:51137102-51137124 GTAGTTTCTCTACTAAACACTGG + Intergenic
933140292 2:78783778-78783800 GAAGTTTCACGATGAAATATGGG + Intergenic
933478822 2:82827470-82827492 GTATTTTCTTTATGAAACAGGGG - Intergenic
933797738 2:85934003-85934025 GTGGTTTCACCATGTAACCCAGG - Intergenic
934733131 2:96672041-96672063 GTGGTTTCACTATGTTACCCAGG - Intergenic
935869400 2:107428674-107428696 GGAGTTTCACTATGTCACCCAGG - Intergenic
936092086 2:109507957-109507979 GTGGGTTCACTAAGAAACGCTGG + Intergenic
936379539 2:111972220-111972242 GTAGTTTCACCATGTCACCCAGG + Intronic
936433947 2:112487022-112487044 GTTGTTTCAGTAGGAAACACTGG + Intronic
939188433 2:138887592-138887614 GTAGTTTCACTCTGTCACCCAGG + Intergenic
939329380 2:140737721-140737743 TTAGTGTCACAATGAAAGACAGG + Intronic
939490214 2:142867954-142867976 GAAGTTTTAATATGACACACCGG - Intergenic
939983158 2:148805274-148805296 GAAGTCTCACTCTGAAACCCAGG + Intergenic
941766441 2:169302327-169302349 GTATTTTCATTAGGAGACACAGG - Intronic
942879975 2:180847739-180847761 GTAATTTAACTGTGAGACACTGG - Intergenic
945484319 2:210377069-210377091 GTACTTTCACTTTGAGACAGTGG + Intergenic
945589150 2:211707568-211707590 GTTGTGTCACAATGAGACACTGG - Intronic
946997105 2:225405924-225405946 GTAATTTTACTTTGAAACAAAGG - Intronic
947045860 2:225982506-225982528 ATAGTTTAACTTTGAAACAAAGG - Intergenic
1171212030 20:23324558-23324580 GGAGGTTCAATATGAAATACAGG + Intergenic
1172532922 20:35646049-35646071 GTAGTTTCACTATGTGGCTCAGG - Intronic
1172542598 20:35732243-35732265 CTAGTTTTACTATGATACAATGG + Intronic
1173909325 20:46652412-46652434 GTAGTCTCACTCTGTAACCCAGG + Intronic
951100389 3:18681529-18681551 TTGGTTTTACTAAGAAACACAGG - Intergenic
951613594 3:24519477-24519499 TTAGTTTCACTTTGAAGCAAAGG - Intergenic
951874842 3:27411711-27411733 GTAGATCCATTGTGAAACACAGG + Exonic
952112899 3:30145177-30145199 ATAGTTTAACTTTGAAACAAAGG + Intergenic
952886498 3:38015686-38015708 TTAGTTACACAATGACACACTGG - Intronic
954084150 3:48230859-48230881 GGAGTTTCACTATGTAAGCCAGG + Intergenic
954562812 3:51572425-51572447 GGAGTCTCACTCTGAAACCCAGG - Intronic
956983257 3:74665532-74665554 TAGGTTTCACTATGAAGCACAGG - Intergenic
958500551 3:94901995-94902017 TGAGTGTCACTATGAAAAACTGG - Intergenic
958566367 3:95816313-95816335 ATAGTTTAACTTTGAAACAAAGG - Intergenic
959652661 3:108766687-108766709 TTAGTCTCACTATGGAAGACTGG + Intergenic
962185748 3:133257974-133257996 GTATTTTCACTATGGGACTCAGG - Intronic
962746619 3:138401807-138401829 TTATTTAAACTATGAAACACAGG + Intronic
962877105 3:139543460-139543482 GGAGTTTCACTGTGATACCCAGG - Intergenic
964095680 3:152928589-152928611 GTAGTTTTACTATATAAAACGGG + Intergenic
967707316 3:192666512-192666534 CAAGTGCCACTATGAAACACAGG + Intronic
967928101 3:194668481-194668503 GTTATTTCACTGTGAAACCCAGG + Intronic
969361810 4:6669164-6669186 GTGGTTTCACTATGTTACCCAGG - Intergenic
970915775 4:21332725-21332747 GTTGTTTCAGTACTAAACACAGG - Intronic
971254059 4:24997901-24997923 GTAGTCTCACTCTGACACCCAGG + Intergenic
974393364 4:61303188-61303210 GTAGTTTTACTTTCAAAGACTGG + Intronic
974393499 4:61305468-61305490 GTAGTTGCTGTAGGAAACACTGG + Intronic
975950097 4:79760198-79760220 GTATTTTCACTATATCACACTGG - Intergenic
977824559 4:101515462-101515484 GAAGTTTCACCATGATACATAGG + Intronic
978411696 4:108433161-108433183 GGAGTTGCACTATGAAAGAATGG + Intergenic
979011064 4:115369205-115369227 GTCATTTCACTCTAAAACACTGG - Intergenic
979137330 4:117126172-117126194 CTATTGTCACTCTGAAACACTGG + Intergenic
979563473 4:122126810-122126832 GTTATTTCACTATCAAAAACAGG + Intergenic
979623256 4:122819220-122819242 GTAGTTTCACTCTGTCACCCAGG + Intergenic
979721017 4:123900456-123900478 GTAGTCTCACTCTGTCACACAGG - Intergenic
980500933 4:133652750-133652772 GGACTTTCAGTATGAAACATAGG - Intergenic
988291441 5:29293584-29293606 GTTATTTCTCTAAGAAACACAGG - Intergenic
989093110 5:37755142-37755164 GGAGTTACAGCATGAAACACAGG - Intergenic
989266752 5:39483586-39483608 ATAGCTTCACTAGGAAAGACTGG + Intergenic
989639429 5:43568799-43568821 GTATTGTCACTATGAAAGATGGG - Intergenic
989720354 5:44520874-44520896 GCTTTTTCACTATGAAAAACTGG + Intergenic
990005820 5:50943290-50943312 GTAGTTTCACTATGTTAGCCAGG - Intergenic
991221157 5:64219846-64219868 GTAGTTTCACTATGAAACACTGG - Intronic
992117588 5:73555634-73555656 TTAATATCACTATGAAAAACTGG + Intronic
992666553 5:79015167-79015189 GTGGATTAACTAGGAAACACAGG - Intronic
993921320 5:93807485-93807507 TTAGTTTCACTATGAAACAGTGG - Intronic
995067844 5:107882456-107882478 GTATTTTCACTGGAAAACACTGG - Intronic
996231871 5:121074410-121074432 GTAATTTCATTATGAAACAGAGG + Intergenic
996877520 5:128255506-128255528 ATAGTTTCAGTGTGAAACAAAGG - Intergenic
998357684 5:141554620-141554642 GTACTTTCACTCATAAACACAGG + Intronic
1000072771 5:157756216-157756238 ATGGTTTCACCATGAAACAGGGG + Exonic
1000845270 5:166272033-166272055 GTAATTACAATATGAAACAAAGG - Intergenic
1002075311 5:176705042-176705064 GTGGCTTCTCTAGGAAACACAGG - Intergenic
1004445357 6:15692920-15692942 ATAGTTTAACTTTGAAACAAAGG + Intergenic
1005728012 6:28668639-28668661 GGATGTTCACTATGAAACAAAGG + Intergenic
1007652244 6:43430280-43430302 GGAGTTTCACTGTGTTACACAGG + Intronic
1008113703 6:47521524-47521546 GGAGTCTCACTCTGCAACACAGG - Intronic
1008330900 6:50242642-50242664 ATATTTTCATTATGAAACAATGG + Intergenic
1009981429 6:70730245-70730267 GTGGTTTCACTATGTTACCCAGG + Intronic
1010045942 6:71443540-71443562 GTATTTTCTCTATGAAATAGGGG - Intergenic
1012456631 6:99413784-99413806 GTATTCTCAGTTTGAAACACTGG + Intronic
1020603284 7:10303471-10303493 GTATTTTTACTATGTAAAACTGG - Intergenic
1020618386 7:10488769-10488791 GTTGAATCACTATCAAACACAGG - Intergenic
1020945900 7:14605998-14606020 CTTGTTTAACTATGAAATACAGG + Intronic
1024029898 7:45450933-45450955 GTAGTTTAACTTTGAAGCAAGGG - Intergenic
1028939258 7:96502381-96502403 GTAGTGGCAGTCTGAAACACTGG + Intronic
1029023553 7:97390575-97390597 GGAGTTTCACTCTGTCACACAGG + Intergenic
1029866702 7:103639181-103639203 GTAGTTTTACTAGAAAACACAGG + Intronic
1029930238 7:104363149-104363171 GTAGTTTGACTTTTAAACAAAGG - Intronic
1030195441 7:106848702-106848724 GTAATTTCACTATTAAAAAAAGG + Intergenic
1030680988 7:112433649-112433671 ATAGTTTAACTTTGAAACAGAGG - Intronic
1032835459 7:135668593-135668615 GTAGTTTCACCATGATGCCCAGG + Intronic
1033503322 7:141975993-141976015 GTAGTGTCAATAGGAAACACTGG + Intronic
1034926175 7:155124148-155124170 GTTGTTTGACTATGAGAAACCGG - Intergenic
1034926177 7:155124170-155124192 GTTGTTTGACTATGAGAAACCGG - Intergenic
1034926179 7:155124192-155124214 GTTGTTTGACTATGAGAAACCGG - Intergenic
1034926184 7:155124236-155124258 GTTGTTTGACTATGAGAAACCGG - Intergenic
1034926186 7:155124258-155124280 GTTGTTTGACTATGAGAAACCGG - Intergenic
1034926188 7:155124280-155124302 GTTGTTTGACTATGAGAAACCGG - Intergenic
1034926192 7:155124324-155124346 GTTGTTTGACTATGAGAAACCGG - Intergenic
1034926200 7:155124390-155124412 GTTGTTTGACTATGAGAAACCGG - Intergenic
1034926209 7:155124478-155124500 GTTGTTTGACTATGAGAAACCGG - Intergenic
1034926211 7:155124500-155124522 GTTGTTTGACTATGAGAAACCGG - Intergenic
1034926213 7:155124522-155124544 GTTGTTTGACTATGAGAAACCGG - Intergenic
1034926218 7:155124588-155124610 GTTGTTTGACTATGAGAAACCGG - Intergenic
1035923545 8:3704043-3704065 GGAGTTTCACTCTGACACCCAGG - Intronic
1039390426 8:37176207-37176229 GTAGTTTCACTCTGTCACCCAGG + Intergenic
1041297233 8:56370199-56370221 ATAGTTTCACTTTGAAACAAAGG + Intergenic
1042921170 8:73921460-73921482 GTAGTCTCACTCTGTAACTCAGG - Intergenic
1044613511 8:94117045-94117067 GTAGTTGCACTATGCAACCATGG - Intergenic
1046470287 8:114663658-114663680 GGAGTTGCACTATGTTACACAGG - Intergenic
1047574066 8:126133572-126133594 CTAGCTTCACTATGACTCACAGG + Intergenic
1047651834 8:126931604-126931626 GAAGTCTCACTCTGAAACCCAGG + Intergenic
1050262187 9:3852117-3852139 GTAGTCTCACTATGTCACCCAGG - Intronic
1051311368 9:15777432-15777454 TTATTTTCACTATGAAAAAAAGG - Intronic
1051371892 9:16365806-16365828 ATAGTTTAACTTTGAAACAAAGG - Intergenic
1052079263 9:24182812-24182834 GCAATTTCACTATAAAAAACTGG + Intergenic
1052180637 9:25522397-25522419 GAAGAAGCACTATGAAACACAGG + Intergenic
1052451269 9:28634509-28634531 GGAGTTTCACTCTGTAACCCAGG + Intronic
1056454863 9:86750592-86750614 GTAGATACACTATGTAACAGAGG - Intergenic
1060678516 9:125539353-125539375 GTAGTCTCATTATGAAATAGAGG - Intronic
1185540642 X:900516-900538 GGAGTTTCACTCTGTCACACAGG - Intergenic
1185983190 X:4802486-4802508 ATAGTTTCACTATGTTACCCAGG - Intergenic
1187466831 X:19534984-19535006 GTAGTTTCACTATTAAACTCAGG + Exonic
1187469709 X:19558132-19558154 GTAGTTACACTATTATCCACAGG + Intronic
1188638278 X:32463913-32463935 GTATTTTCATTTTCAAACACAGG + Intronic
1189403730 X:40697749-40697771 GTAGTTTCATTATGCATCAGTGG - Intronic
1189692161 X:43627855-43627877 TTAGTCTCACTTTGAGACACAGG - Intergenic
1191235714 X:58132160-58132182 GTACTTTCATTGTGAAAAACAGG + Intergenic
1193525888 X:82588489-82588511 GTAGTTACAATGTAAAACACTGG + Intergenic
1194047747 X:89030300-89030322 GAAATTTAACAATGAAACACTGG - Intergenic
1194226075 X:91259468-91259490 GGAGTTTCACCATGTCACACAGG + Intergenic
1197503327 X:127269356-127269378 GTATTTTCATAAAGAAACACGGG - Intergenic
1200370317 X:155717984-155718006 GTAGTTTTACTATGATATTCTGG - Intergenic
1200749697 Y:6933600-6933622 GTTCTTTCACGATGAAAGACAGG - Intronic
1200869993 Y:8087614-8087636 TTGGTATCACTATGAAACACAGG + Intergenic