ID: 991223087

View in Genome Browser
Species Human (GRCh38)
Location 5:64237912-64237934
Sequence CTCCATGATTGCAAGTTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 580
Summary {0: 1, 1: 2, 2: 65, 3: 171, 4: 341}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991223079_991223087 19 Left 991223079 5:64237870-64237892 CCTGCTGCCATGTACAATGTACC 0: 1
1: 2
2: 48
3: 550
4: 1323
Right 991223087 5:64237912-64237934 CTCCATGATTGCAAGTTTCCTGG 0: 1
1: 2
2: 65
3: 171
4: 341
991223081_991223087 -2 Left 991223081 5:64237891-64237913 CCTTTCTTCCCCTTTACCTTCCT 0: 1
1: 4
2: 100
3: 924
4: 4333
Right 991223087 5:64237912-64237934 CTCCATGATTGCAAGTTTCCTGG 0: 1
1: 2
2: 65
3: 171
4: 341
991223082_991223087 -10 Left 991223082 5:64237899-64237921 CCCCTTTACCTTCCTCCATGATT 0: 7
1: 157
2: 2088
3: 6012
4: 7854
Right 991223087 5:64237912-64237934 CTCCATGATTGCAAGTTTCCTGG 0: 1
1: 2
2: 65
3: 171
4: 341
991223080_991223087 12 Left 991223080 5:64237877-64237899 CCATGTACAATGTACCTTTCTTC 0: 1
1: 0
2: 5
3: 82
4: 756
Right 991223087 5:64237912-64237934 CTCCATGATTGCAAGTTTCCTGG 0: 1
1: 2
2: 65
3: 171
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991223087 Original CRISPR CTCCATGATTGCAAGTTTCC TGG Intronic
900108078 1:993997-994019 TGCCAGGATTGGAAGTTTCCTGG + Intergenic
901365213 1:8741650-8741672 CACCATGATTGTAAGTTTCCTGG + Intronic
901943831 1:12684903-12684925 CACCACGACTGGAAGTTTCCTGG - Intergenic
902541248 1:17156788-17156810 TGCCATGATTGAAAGCTTCCTGG - Intergenic
903204194 1:21768313-21768335 GTCCCTGATTGCTATTTTCCAGG + Intronic
903343066 1:22666855-22666877 CTGCATGCTAGCAAGTTTCTAGG - Intergenic
907147562 1:52249153-52249175 TGTCATGATTGTAAGTTTCCTGG + Intronic
907678147 1:56537729-56537751 CTTCATGAATGCCATTTTCCAGG + Intronic
909110960 1:71476793-71476815 CTCCATGTTTGCAACTTTCCTGG + Intronic
909304574 1:74057016-74057038 CGCTATGATTGTAAGTTTCCTGG + Intronic
909418016 1:75429651-75429673 CACCATGACTGGAAATTTCCTGG - Intronic
909553382 1:76925027-76925049 CATCATGATTGTAAGCTTCCTGG - Intronic
910240708 1:85082962-85082984 CACCATTATTGCACATTTCCAGG + Intronic
911343640 1:96671055-96671077 TGCCATGATTGTAAGTTTCCTGG - Intergenic
912502852 1:110133721-110133743 CTCCATGGTTGGAAGCTTCCTGG + Intergenic
912632936 1:111263551-111263573 CACCATGATTGTAAGTTTCCTGG + Intergenic
912984904 1:114418118-114418140 TGCCATGATTGTAGGTTTCCTGG - Intronic
914020230 1:143859594-143859616 CACCGCGATTGTAAGTTTCCTGG - Intergenic
914658730 1:149767506-149767528 CACCGCGATTGTAAGTTTCCTGG - Intergenic
915719054 1:157970675-157970697 CACCATGATTGGAAGGTTCCTGG - Intergenic
916004795 1:160649662-160649684 CACCATGATTGTAAGTTTCCTGG + Intergenic
917215290 1:172671727-172671749 CCACATTATTGCAGGTTTCCTGG + Intergenic
918366014 1:183808430-183808452 CTCCTTTATTGCAAGTTCCTAGG + Intronic
918740460 1:188124221-188124243 TGCCATGATTGAAAGTTCCCTGG + Intergenic
919013329 1:191993693-191993715 CTTCATGATGGCGAGTTTCTAGG - Intergenic
919129094 1:193431990-193432012 TACCATTATTGTAAGTTTCCTGG - Intergenic
919129357 1:193433888-193433910 CACCATAATTGTAAGTTTCCTGG - Intergenic
920644059 1:207784722-207784744 CTCCATGATTATAAGTTTCCTGG - Intronic
920846653 1:209599025-209599047 TGCCATGATTGTCAGTTTCCTGG - Intronic
920869638 1:209783450-209783472 CTCTATGATTGCAACTGTGCAGG - Exonic
921567129 1:216734553-216734575 CGCCATGATTATAAGCTTCCTGG + Intronic
921960402 1:221027870-221027892 CACCATGAGTGGAAGCTTCCTGG + Intergenic
922135574 1:222821982-222822004 CACCATGATTGTAAGTTTCCTGG + Intergenic
922352074 1:224742548-224742570 CACCATGATTAGAAGCTTCCTGG - Intergenic
922900655 1:229134040-229134062 TGCCATGATTGTAAGTTTCCTGG + Intergenic
924903602 1:248428380-248428402 CCCCATGATTGTGTGTTTCCCGG + Intergenic
924924267 1:248663598-248663620 CCCCATGATTGTGTGTTTCCCGG - Intergenic
1063624899 10:7679835-7679857 CGCCATGGTTTTAAGTTTCCTGG - Intergenic
1063917603 10:10899718-10899740 CGCCATGATTGTAAGTTTCCTGG - Intergenic
1065837618 10:29673513-29673535 CGCCATGATTTTAAGTTTCCTGG - Intronic
1066247495 10:33597500-33597522 CACCATGATTGTAAGTTTCCTGG + Intergenic
1066482711 10:35812520-35812542 CACCATGATTGTAAGTTTCCTGG + Intergenic
1066542116 10:36458627-36458649 TGCCATGATTGTAAGTTTCCTGG - Intergenic
1067197683 10:44136504-44136526 GACCATGATTTCCAGTTTCCAGG + Intergenic
1068156625 10:53206925-53206947 TACCATGATTGTAAGCTTCCTGG + Intergenic
1068255069 10:54498866-54498888 CATCATGATTGAAAGTTTCCTGG - Intronic
1068712262 10:60147760-60147782 CCCTATGATTGTAAGTTTCCTGG + Intronic
1069354508 10:67568200-67568222 CTCAATGTTTGCAAGACTCCAGG + Intronic
1071375181 10:84995198-84995220 TTCCATGACTGTAAGCTTCCTGG - Intergenic
1071737924 10:88322583-88322605 TGCCATGATTATAAGTTTCCTGG + Intronic
1073689028 10:105787003-105787025 TGCCATGATTGTAAGTTTCCTGG - Intergenic
1076195142 10:128512440-128512462 CTCCCTGCTTCCAAGTTTACAGG - Intergenic
1076382187 10:130031608-130031630 TGCCATGATTGTAAGTTTCCTGG - Intergenic
1076620328 10:131783169-131783191 CACCATGATTGTAAGTTTCCTGG + Intergenic
1076745538 10:132511208-132511230 CGCCATGATTGTAAGTTTCCTGG - Intergenic
1078553960 11:12302972-12302994 CACCACGATTGTAAATTTCCTGG - Intronic
1078645656 11:13139581-13139603 TGCTATGATTGTAAGTTTCCTGG - Intergenic
1078684739 11:13518457-13518479 CACCATGATTGTAATTTTCCTGG + Intergenic
1079475379 11:20824231-20824253 TGCCATGAATGCAAGTTTCCTGG + Intronic
1079559738 11:21807109-21807131 CACCAAGATTGTAAGTTTCCTGG - Intergenic
1079721799 11:23825197-23825219 CACCATGATTGTAAGTTTGGTGG - Intergenic
1080167118 11:29251999-29252021 TGACATGATTGTAAGTTTCCTGG + Intergenic
1080228019 11:29983039-29983061 CACCATGATTGTAAGTTTCCTGG - Intergenic
1080925154 11:36748521-36748543 CTCCTTGCTTGCAAGCTCCCTGG + Intergenic
1081090094 11:38853821-38853843 CACCATGATTTTAAGTTTCCTGG + Intergenic
1081441605 11:43086897-43086919 CGTCATGATAGTAAGTTTCCTGG - Intergenic
1082898972 11:58225523-58225545 CACCATGATTGTAAGTTTCCTGG - Intergenic
1083519264 11:63292604-63292626 CACCATGATTGTAAGTTTCCTGG - Intronic
1085557490 11:77438152-77438174 TGCCATGATTGTAAGTGTCCTGG - Intronic
1085939809 11:81195513-81195535 TGCCATGATTGCAAGTTTCCTGG + Intergenic
1085986176 11:81791465-81791487 TACCATAATTGTAAGTTTCCTGG - Intergenic
1086055576 11:82642446-82642468 CACCATGATTGTAAGTTTCCTGG + Intergenic
1086828742 11:91533540-91533562 CACCATGATTGTAAATTTCCTGG + Intergenic
1087271678 11:96118456-96118478 TGCCATGATTGTAAGTTTCCTGG + Intronic
1088005940 11:104940360-104940382 CACCATGTTTGGCAGTTTCCTGG - Intergenic
1088988983 11:114935211-114935233 CTCAATGAGTGGTAGTTTCCTGG + Intergenic
1089542198 11:119195993-119196015 CTCCATGTTTCCCAGTTGCCTGG - Intronic
1090523224 11:127501081-127501103 CACCATGACTGTAAGTTTCCTGG + Intergenic
1090842991 11:130508830-130508852 TGCCATGATTGTAAGTTTCCTGG + Intergenic
1092964755 12:13630916-13630938 CACCATGATTTTGAGTTTCCTGG - Intronic
1093068335 12:14682436-14682458 TGCCATGATTGTAAGTTTCCTGG + Intronic
1094281935 12:28749824-28749846 TACCATGATTGGAAGCTTCCTGG + Intergenic
1094308394 12:29048824-29048846 TGCCATGATAGTAAGTTTCCTGG - Intergenic
1095143685 12:38697862-38697884 CATCATGATTGAAAGCTTCCTGG + Intronic
1095478154 12:42607278-42607300 ATGCATGATTTCAAGTTTCAAGG + Intergenic
1095908411 12:47401476-47401498 CATCATGATTGTAAGTTTCCTGG + Intergenic
1097312968 12:58141242-58141264 CACCATGTTTGTAAGCTTCCTGG + Intergenic
1097442954 12:59633698-59633720 CACCATGACCGTAAGTTTCCTGG - Intronic
1097622714 12:61961042-61961064 CGCCATGATTGTAAGTTTCCTGG + Intronic
1097860983 12:64518384-64518406 CACCATGACTGGAAGCTTCCTGG - Intergenic
1098317499 12:69207756-69207778 TGCCATAATTGTAAGTTTCCTGG + Intergenic
1099085209 12:78237534-78237556 TACCATGATTGCAAGTTTCCTGG - Intergenic
1099668790 12:85663758-85663780 TGCCATGATTGTAAGTTTCCTGG - Intergenic
1099734441 12:86550173-86550195 TGCCATGATCGTAAGTTTCCTGG + Intronic
1099890963 12:88587745-88587767 CACCATGATTGTAAGCTTCTTGG - Intergenic
1100380947 12:94061163-94061185 CATCATGACTGTAAGTTTCCTGG + Intergenic
1100791461 12:98134657-98134679 TGCCATGATTGTAAGTTTTCTGG + Intergenic
1101404047 12:104412649-104412671 TGCCATGATTATAAGTTTCCTGG + Intergenic
1102666857 12:114581504-114581526 TGCCATGATTGTAAATTTCCTGG - Intergenic
1102827034 12:115956632-115956654 CTCAATGAATTCAAGTTCCCAGG - Exonic
1103833324 12:123798322-123798344 CACCATGATTGGGAGTTTCCTGG - Intronic
1104139182 12:125971019-125971041 TTGCGTGATTACAAGTTTCCTGG + Intergenic
1104399055 12:128460679-128460701 GTCAATGAATGCAAGTTTGCAGG + Intronic
1104497559 12:129255145-129255167 CTGCATGATTCTAAGTTTCCTGG + Intronic
1104519230 12:129457665-129457687 CGACATGATTGTAAGTTTCCTGG - Intronic
1104611252 12:130229535-130229557 CACCATGATTCTAAGTTTCCTGG - Intergenic
1106363407 13:29053001-29053023 CTTCATGATTGTAAGTTTCCTGG + Intronic
1107329208 13:39280040-39280062 CACCATGATTGTAAGCCTCCTGG + Intergenic
1107663586 13:42665247-42665269 TCCCATGATTGTAAGTTTCCTGG + Intergenic
1108154735 13:47573670-47573692 TGCCATAATTGTAAGTTTCCTGG + Intergenic
1109490950 13:63099689-63099711 CACCATGAATGTAAGTTTCCTGG + Intergenic
1109672342 13:65625844-65625866 CACCATGATTGTAAGCTTCCTGG - Intergenic
1109906380 13:68846980-68847002 CACCATGATTGTATCTTTCCTGG + Intergenic
1109954872 13:69552512-69552534 CACCATGATTGTAAGCTTCTTGG + Intergenic
1110623636 13:77626696-77626718 TGCCATGATTGTAAGTTTCCTGG + Intronic
1110888294 13:80666552-80666574 CACCATGATGGCAAGTTCCTTGG - Intergenic
1110893048 13:80713938-80713960 CACCATGATTGTAAGTTTCTTGG - Intergenic
1111038025 13:82704889-82704911 TGCCATGATTGTAAGTTTCCTGG - Intergenic
1111107940 13:83670238-83670260 CACCATGATTGTATGTTTCCTGG + Intergenic
1111300065 13:86337253-86337275 CACCATGATTGTAAGTTTTTAGG + Intergenic
1111908361 13:94282270-94282292 TGCCATGATTGTAAGTTTCCTGG - Intronic
1112024981 13:95403720-95403742 CAACATGATTGGAAGCTTCCTGG - Intergenic
1112426604 13:99307816-99307838 CTCCCTGATACCAAGTTTCCAGG - Intronic
1112623783 13:101079066-101079088 CACCATGATTGTAAGTTGCCTGG + Intronic
1112753899 13:102609291-102609313 CCCCATGATTGTAAGTTTCCTGG - Intronic
1112932905 13:104763582-104763604 CCCCATGATTGGAAGTTTCCTGG + Intergenic
1113087656 13:106584825-106584847 TGCCATGATTGTAAGTTTCCTGG + Intergenic
1113158947 13:107357200-107357222 TGCCATGATTGTGAGTTTCCTGG - Intronic
1113252893 13:108473321-108473343 TGCCAGGATTGTAAGTTTCCTGG + Intergenic
1114383280 14:22231466-22231488 CACCATGATTATAAGCTTCCTGG - Intergenic
1114927385 14:27421319-27421341 CACCATGATTCTAAGCTTCCTGG - Intergenic
1115456301 14:33607807-33607829 CGCCATGATTCTGAGTTTCCTGG - Intronic
1116060748 14:39921348-39921370 CGCCATGATTATAAGCTTCCTGG - Intergenic
1116116189 14:40654112-40654134 TGCCATGATTGTAAGTTTACTGG - Intergenic
1117533984 14:56686772-56686794 CTCTATGCTTGCAGGGTTCCTGG - Intronic
1117739553 14:58802842-58802864 TGCCATGATTGTAAGTTTCCTGG - Intergenic
1118596360 14:67438278-67438300 CTCCCTGCTTGCCAGGTTCCTGG - Intergenic
1118945672 14:70384798-70384820 AACCATGATTTTAAGTTTCCTGG + Intronic
1119631071 14:76232704-76232726 CTCCATGCCTGCAACCTTCCTGG - Intronic
1120316718 14:82903658-82903680 CACCATGATTGTAAGTTTCCTGG + Intergenic
1120377922 14:83733120-83733142 CACCATGATTCCAAGTTTCCTGG + Intergenic
1121038286 14:90724631-90724653 CATCATGATTGCAAATTTCTTGG + Intronic
1121550537 14:94796237-94796259 CTCCACGGGTCCAAGTTTCCAGG - Intergenic
1121791808 14:96704616-96704638 CTCCATGGTTACAAGCTCCCGGG - Intergenic
1121983587 14:98477017-98477039 CTCCAGCCATGCAAGTTTCCAGG + Intergenic
1122089568 14:99329252-99329274 CGCCATGATTGTAAGTTTCCTGG + Intergenic
1124086830 15:26558972-26558994 TGCCATGATTATAAGTTTCCTGG - Intronic
1124203011 15:27694438-27694460 CGCCATGATTGTAAGCTTCCTGG + Intergenic
1124591528 15:31057961-31057983 CGCCATGATTGTAAGTGTCCTGG + Intronic
1124607988 15:31185235-31185257 CTCCCTAATCGCAAGTTCCCAGG + Intergenic
1125417839 15:39471969-39471991 CTCCATGCTTGCACGCTGCCTGG - Intergenic
1126197551 15:45949128-45949150 TGCCATAATTGTAAGTTTCCTGG + Intergenic
1126290530 15:47071294-47071316 TGTCATGATTGCATGTTTCCTGG + Intergenic
1126359894 15:47835446-47835468 TGCCATGATTGTAAGCTTCCTGG - Intergenic
1126900485 15:53309506-53309528 CACCATGATTGTAAGTTTCCTGG - Intergenic
1127000523 15:54499137-54499159 TGCCATGATTGAAAGCTTCCTGG - Intronic
1127028593 15:54835519-54835541 CACCATGATTGTAAGCTTCCTGG + Intergenic
1128301926 15:66571331-66571353 CACTATGATTGTAAGTTTCCTGG + Intergenic
1128474475 15:67985347-67985369 TGCCATGATTGTAAGTTTCTTGG - Intergenic
1128515715 15:68340680-68340702 CTCCTTGAGGGAAAGTTTCCAGG + Intronic
1128860652 15:71068537-71068559 CGCCATGATTATAAGTTTCCCGG + Intergenic
1129503036 15:76058978-76059000 GGCCATGATTGCCAGTTACCGGG - Intronic
1132212399 15:100034169-100034191 CTCCAGGATTACAATTCTCCTGG + Intronic
1133767477 16:8848093-8848115 CTACATGATTGCACGTATCAGGG - Exonic
1133865293 16:9636646-9636668 CACTATGATTGGAAGCTTCCTGG - Intergenic
1133887064 16:9840202-9840224 TGCCATGATTGTAAGTTTCCTGG - Intronic
1134816899 16:17213254-17213276 CACCACAATTGTAAGTTTCCTGG + Intronic
1135053112 16:19208397-19208419 CACCATGATTGTAAGTTTCCTGG - Intronic
1135174964 16:20219715-20219737 CGCCGTGATTGTAAGTTTCCTGG + Intergenic
1136423699 16:30154252-30154274 TGCCATGATTTTAAGTTTCCTGG + Intergenic
1136527373 16:30840720-30840742 CGCCATGACTGTAAGTTTCCTGG - Intronic
1137340820 16:47602454-47602476 CCCCATGGTTACAAGTTTGCTGG - Intronic
1138293422 16:55867336-55867358 CTGCACAATTGCATGTTTCCCGG + Intronic
1139737310 16:69002583-69002605 CACCATGATTGTAAGTTTCCTGG + Intronic
1140343398 16:74188217-74188239 CACCATAATTGTAAGTTTCCTGG - Intergenic
1141188674 16:81807771-81807793 CACCATGATTGTAAGCTTCCTGG - Intronic
1141275636 16:82585423-82585445 TTCTATTATTGGAAGTTTCCAGG - Intergenic
1141692454 16:85604044-85604066 CCTCATGATTGTAAATTTCCTGG - Intergenic
1141845751 16:86607820-86607842 CGCCATGATTGTAAGTTTCCTGG - Intergenic
1143308638 17:5970009-5970031 TGCCATGATTGAAAGTTTCCTGG + Intronic
1143989251 17:10942768-10942790 CTCCATGGGTGCACGTGTCCTGG + Intergenic
1145000375 17:19300723-19300745 CTCCAAGATTGACAGTTTGCCGG - Intronic
1146585620 17:34079042-34079064 GACCATGATTGCAAGAGTCCAGG - Intronic
1147043690 17:37737102-37737124 ATACATGATTACAAATTTCCTGG - Intronic
1149025224 17:52019039-52019061 CACCATGATTGGAAGCTTCTGGG + Intronic
1149447614 17:56725763-56725785 CTCCATGATTCCAAGAACCCTGG + Intergenic
1150515599 17:65806732-65806754 TGCCATGATTGTAAGTTTCCTGG + Intronic
1151069260 17:71189662-71189684 TGCCATGTTTGTAAGTTTCCTGG - Intergenic
1151210675 17:72541649-72541671 TGCCATGATTGGAAGCTTCCTGG + Intergenic
1153276114 18:3369267-3369289 CGCCATGATTGTAAGCTCCCTGG + Intergenic
1153606237 18:6836286-6836308 CTTGTTGATTGCAAGTGTCCCGG - Intronic
1155671992 18:28382750-28382772 CACCATGATTGTAAGTTTCCTGG + Intergenic
1156122800 18:33864815-33864837 TGCCATGATTGTAAGTTTCCTGG - Intronic
1156238571 18:35228900-35228922 CTCCATGATTTTAAGTTTCCTGG + Intergenic
1157468359 18:47967917-47967939 CTCCATGCTTAGAACTTTCCTGG - Intergenic
1157728837 18:49986469-49986491 CTCTATGAGTGAAGGTTTCCTGG + Intronic
1157876551 18:51279235-51279257 CTCCATGCTTGGAATTTTCCTGG - Intergenic
1158389029 18:57028110-57028132 CTACAGGATTGCAAGTTTTCCGG - Exonic
1158780315 18:60641329-60641351 CACCATGATTGTACGTTTCATGG - Intergenic
1159587147 18:70291464-70291486 CTCCATTATGGCCAGTTTTCAGG + Intronic
1159839148 18:73376532-73376554 TGCCATAATTGTAAGTTTCCTGG - Intergenic
1160482988 18:79260195-79260217 CGCCATGATTGCAAGTTTCCTGG - Intronic
1161903167 19:7134958-7134980 CTCGATGCTTGCAGGTTTCATGG - Intronic
1163331301 19:16639844-16639866 CGCCATGACTGTAAGTTTCCTGG + Intronic
1164406695 19:27954558-27954580 CTCCATGATTTGAAGTTTACTGG - Intergenic
1164475954 19:28576185-28576207 CACCATGAGTGGAAGCTTCCTGG - Intergenic
1166157646 19:40926265-40926287 TACCATGATTGTAAGTTTCCTGG - Intergenic
1166281852 19:41799378-41799400 CACCATGATTGTAAGCTTGCTGG + Intronic
1167548230 19:50141690-50141712 CTCCCTAATCGCAAGTTCCCAGG + Intergenic
1167623981 19:50574774-50574796 TTCTATGATTGAAAGCTTCCTGG + Intergenic
1168507310 19:56947235-56947257 TGCCGTGATTGTAAGTTTCCTGG - Intergenic
925256906 2:2498215-2498237 AGCCATCATTGTAAGTTTCCTGG + Intergenic
925653439 2:6117542-6117564 TGCCATGATTGTAAGTTTCCTGG + Intergenic
925690182 2:6514408-6514430 TTCCATGATTGTAAGCTTCCTGG - Intergenic
925873059 2:8287371-8287393 CTCCATGATGGCAGGTGTCCTGG + Intergenic
925931137 2:8709107-8709129 CTACATGATTGAATGTATCCAGG - Intergenic
926226308 2:10969550-10969572 CACCATGATTGTAAGTTTCCTGG - Intergenic
926504807 2:13700207-13700229 CACCATGATTGTAAGTTTCTTGG + Intergenic
926742011 2:16119530-16119552 TGCCATAATTGTAAGTTTCCTGG + Intergenic
926911555 2:17856351-17856373 TGCCATGATTGTAAGTTTCCTGG + Intergenic
927356363 2:22177933-22177955 TGCCATGATTGTAAGTTTCCTGG - Intergenic
928220083 2:29396191-29396213 CTCCATGGTGGCAAGTATCCTGG + Intronic
928707409 2:33965043-33965065 CACCATGATTGTAAGTTTCCTGG + Intergenic
928745647 2:34411445-34411467 TTCCCTGATTTCAAGTTTACTGG - Intergenic
929367711 2:41180560-41180582 CGCCATGATTGTAAGTTTCCTGG + Intergenic
929881414 2:45840433-45840455 GTCCATGATTTTAAGTTTCTGGG - Intronic
932879385 2:75486743-75486765 TGCCATGATTATAAGTTTCCTGG + Intronic
933046308 2:77540985-77541007 CACCATGATTGTAAGTTTCCTGG + Intronic
933756384 2:85642157-85642179 CTCCATGATTCTAAGAGTCCTGG - Intronic
936655517 2:114481812-114481834 CTGCCTGATTATAAGTTTCCAGG - Intronic
937487626 2:122332215-122332237 CTCCACCATTGCATTTTTCCTGG - Intergenic
937806355 2:126150261-126150283 CACCATGATTGTAAGTTTCCTGG - Intergenic
938827556 2:135020834-135020856 CACCATGATTGTAAGTTTCCTGG + Intronic
939453199 2:142399579-142399601 TGCCATGATTGTAAGCTTCCTGG + Intergenic
941073544 2:160981786-160981808 TGCCATGATTGTAAGTTTCCTGG + Intergenic
941242891 2:163062973-163062995 ATTCATGTTTACAAGTTTCCAGG - Intergenic
942059111 2:172211573-172211595 TGCCATGATTGTAAGTTTCCTGG - Intergenic
942203094 2:173592121-173592143 CACCATAATTGTGAGTTTCCTGG - Intergenic
942527450 2:176869709-176869731 CACCATGACTGTAAGCTTCCTGG + Intergenic
942870881 2:180732806-180732828 CTCCATGCCTGCAGCTTTCCTGG - Intergenic
942961468 2:181834513-181834535 CACCATGATTGTAAATTTCCTGG - Intergenic
943892701 2:193310704-193310726 CTTCTTGCTTGCAAGTTTTCTGG - Intergenic
944304097 2:198158704-198158726 TGCCACGATTGTAAGTTTCCTGG + Intronic
944972299 2:205007216-205007238 CACCGTGATTGTAAGTTTTCTGG + Intronic
945106588 2:206321773-206321795 CACCATGATTGTAAGTTTCCTGG - Intergenic
945336726 2:208600928-208600950 TACCATGACTGTAAGTTTCCTGG - Intronic
945975668 2:216268557-216268579 TGCCATGATTGTAAGTTTCCTGG + Intronic
946438054 2:219672201-219672223 CTCCATGATTGTAAGTTTTCTGG + Intergenic
946709708 2:222493259-222493281 CACCATAATTGTGAGTTTCCTGG - Intronic
947091759 2:226520134-226520156 CATCATCATTGTAAGTTTCCTGG - Intergenic
948710858 2:239824701-239824723 TGCCATGATTGGAAGCTTCCTGG + Intergenic
948799306 2:240424291-240424313 CTCCATGCCTGCAGGTTTTCTGG - Intergenic
1169260575 20:4135351-4135373 TTCCATGCTTGGAAATTTCCAGG - Intronic
1169518524 20:6345401-6345423 CGCCATCATGGTAAGTTTCCTGG - Intergenic
1170081792 20:12484530-12484552 TGCCATAATTGTAAGTTTCCTGG + Intergenic
1171252659 20:23661183-23661205 CTCCACAATTGCAACTGTCCGGG - Intergenic
1172729058 20:37070296-37070318 CTCCCTAATCGCAAGTTCCCAGG + Intronic
1172797365 20:37550307-37550329 CTCCCTAATCGCAAGTTCCCAGG - Intergenic
1172910911 20:38408160-38408182 CTCCCTAATCGCAAGTTCCCAGG + Intergenic
1173011526 20:39187367-39187389 CGCCATGATTGTAAGCTTCCTGG + Intergenic
1173399184 20:42709478-42709500 CACCATTATTGGAAGCTTCCTGG + Intronic
1174916058 20:54655115-54655137 CGCCATGACTGTCAGTTTCCTGG + Intergenic
1175037290 20:56011890-56011912 TTTCATGATTGCAATTTTCTTGG - Intergenic
1175054423 20:56185266-56185288 CACCATGATTGTAAGTTTCCTGG + Intergenic
1175774485 20:61644480-61644502 CTCCTTTATTGCAAGTATCTGGG - Intronic
1175932966 20:62502100-62502122 CGCCATGATTGTAAGTTTCCTGG + Intergenic
1176617020 21:9033761-9033783 CATCATGATTGTAAGTGTCCCGG + Intergenic
1176696993 21:9989942-9989964 CTCAATGATTTCAATTTTCCTGG + Intergenic
1177259479 21:18711703-18711725 TGCCATGATTGTAAGTTTCCTGG + Intergenic
1177316472 21:19468803-19468825 CGCCTTCATTGTAAGTTTCCTGG - Intergenic
1177329727 21:19642556-19642578 CATCATGATTGTCAGTTTCCTGG + Intergenic
1177392502 21:20494722-20494744 TGCTATGATTGTAAGTTTCCTGG - Intergenic
1177613885 21:23490980-23491002 CACCATGATTGTAGGTTACCTGG + Intergenic
1177802271 21:25839695-25839717 TGCCATGATTGTAAGTTTCCTGG - Intergenic
1178324498 21:31632734-31632756 TGCCATGATTGGAAGCTTCCTGG + Intergenic
1179020887 21:37639909-37639931 TGCCATGATTGTAAGTTTCCTGG + Intronic
1179043285 21:37823655-37823677 CGCCATGATTGTAAGTTTCTTGG + Intronic
1179045298 21:37838999-37839021 CACCATGATTGTAAGTTTCCTGG + Intronic
1179349167 21:40591192-40591214 CATCATGATTGTAAGTTTCCTGG + Intronic
1179432505 21:41333518-41333540 TGCCATGATTGTAAGTTTCCTGG + Intronic
1181507991 22:23374617-23374639 CTGCACAATTGCATGTTTCCTGG + Intergenic
1181561590 22:23706081-23706103 CTCCCTGATTTCAAATTTCATGG + Intergenic
1182823827 22:33244800-33244822 CTCCATGATTAGAAGCATCCTGG - Intronic
1183719395 22:39553508-39553530 CTCTAAGATTCCAGGTTTCCAGG - Intergenic
1184615194 22:45633198-45633220 TTCCATGATTTCTATTTTCCAGG - Intergenic
1184891673 22:47383256-47383278 TGCCATGATTATAAGTTTCCTGG + Intergenic
1185008116 22:48297489-48297511 TGTCATGATTGCAAGTTTCCTGG + Intergenic
1185198056 22:49484737-49484759 CTCCATGATGGAAGGTTTCTTGG - Intronic
949696806 3:6706632-6706654 GACCATGATTGAAAGTTACCTGG - Intergenic
949808960 3:7985445-7985467 TGCCATAATTGTAAGTTTCCTGG + Intergenic
950835350 3:15914080-15914102 CACCATGATCGTAAGTTTCCTGG - Intergenic
951041138 3:17989888-17989910 CTGCATGATTACAAGCTTCAAGG - Intronic
951268966 3:20602501-20602523 TGCCATAATTGTAAGTTTCCCGG + Intergenic
951860932 3:27251546-27251568 CACCATGAATGTAAGTTTCCTGG + Intronic
952185418 3:30962705-30962727 CATCATGATTGCGAGCTTCCAGG - Intergenic
952251044 3:31654616-31654638 CTCCATGATATCAAGTTTTTAGG - Intergenic
952599139 3:35057678-35057700 CTCCATGCTTGAAATTTTCCTGG + Intergenic
953093824 3:39755416-39755438 TGTCATGATTGCAAGTTTCCTGG - Intergenic
953495282 3:43380948-43380970 CGCCATGATTGTATGTTTCCTGG - Intronic
955928833 3:64034965-64034987 CTCCATTATTTCAAATGTCCAGG + Intergenic
956323667 3:68026938-68026960 TGCCATGATTGGAAGCTTCCTGG - Intronic
957174389 3:76786953-76786975 TGCCATGATTGTAAATTTCCTGG - Intronic
957411158 3:79841923-79841945 TGCCATGATTGAAAGTTTCCTGG + Intergenic
957979199 3:87486776-87486798 TGCCATGATTGTAAGTTTCCTGG - Intergenic
957987778 3:87593762-87593784 CACCATGATTGTAAGTTTCCTGG - Intergenic
958473004 3:94545199-94545221 CTAAATGATTTCAAGTCTCCAGG - Intergenic
958474795 3:94567796-94567818 TACCATGATTGTAAGTTTCCTGG + Intergenic
958539621 3:95454036-95454058 CACCATGATTGTAAGTTTCCTGG + Intergenic
958699109 3:97566115-97566137 CACCACGATTGTAAGTTTCCTGG - Intronic
958754405 3:98233707-98233729 TGCCATGATTGTAAGTTTCCTGG + Intergenic
959021418 3:101191439-101191461 CTGCATGAGTGGAACTTTCCTGG - Intergenic
959124264 3:102271231-102271253 CACCATAATTGTAAGTTTCCTGG - Intronic
959214918 3:103438697-103438719 CACCATGATTGTAAGTGTTCTGG - Intergenic
959655576 3:108800609-108800631 TGCCATGATTGGAAGCTTCCTGG + Intergenic
960474772 3:118110411-118110433 CTCTTTGATTGCAAACTTCCAGG + Intergenic
960498832 3:118410257-118410279 CACCATGATTGTAACTTTCCTGG + Intergenic
960625881 3:119681833-119681855 CACCATGATTGTAAGTCTCCTGG - Intergenic
961314854 3:126027397-126027419 CCCCATGCTTGTAAGTTTCCTGG + Intronic
961833444 3:129637466-129637488 CACCATGATTGTGAGTGTCCTGG - Intergenic
962294790 3:134173484-134173506 CGTCATGATTGTAAGTTTCCTGG - Intronic
962333980 3:134509205-134509227 CGCCATAACTGAAAGTTTCCTGG - Intronic
962931100 3:140037174-140037196 ATGCATGTTTGAAAGTTTCCGGG - Intronic
962984251 3:140520375-140520397 CACCATGATTATAAGTTTCCTGG - Intronic
964523318 3:157590270-157590292 CACCAGGAATGCAAGATTCCAGG - Intronic
965096849 3:164240378-164240400 CTACAGGAAGGCAAGTTTCCTGG + Intergenic
966013076 3:175105912-175105934 TTCCATGATCACAAGTTTTCAGG + Intronic
966824538 3:183952714-183952736 CACCATGATTGTAAGTTTCCTGG + Intronic
967704106 3:192630196-192630218 TGCCATCATTGTAAGTTTCCTGG + Intronic
967778014 3:193404675-193404697 CGCCATGATTGAAAGTTTCTTGG + Intronic
969896286 4:10308097-10308119 CTCCATGATTGTTAGTTACAGGG + Intergenic
970346175 4:15154204-15154226 TGCCATGATTGTAAGTTTCCTGG + Intergenic
970351012 4:15201769-15201791 TGCCATGATTTTAAGTTTCCTGG + Intergenic
970523717 4:16910926-16910948 CTCTGTGGGTGCAAGTTTCCAGG - Intergenic
970704282 4:18782064-18782086 TGCCATGGTTGTAAGTTTCCTGG - Intergenic
971157252 4:24096218-24096240 CACCATGATTATAAATTTCCTGG + Intergenic
971587354 4:28421615-28421637 CACCATGACTGTAACTTTCCTGG - Intergenic
971598825 4:28567513-28567535 CACCATGATAGTAAGTATCCTGG - Intergenic
971711020 4:30112810-30112832 TGCCATGATTGTAAGTTTCCTGG - Intergenic
971908953 4:32769223-32769245 CACTATGATTGCAGTTTTCCTGG - Intergenic
971912873 4:32818456-32818478 CACCATGATTAGAAGCTTCCTGG - Intergenic
971943717 4:33246985-33247007 CACCATGATAGTAAGTTTGCTGG - Intergenic
972091000 4:35283463-35283485 TGCCATGATTGTAAGTTTTCTGG + Intergenic
972140278 4:35950759-35950781 CAACATGATTTTAAGTTTCCTGG - Intronic
972758773 4:42080414-42080436 CTTCATGTTTGGAACTTTCCTGG - Intronic
973851560 4:54966173-54966195 CACCATGAATGTAAGTTTCTTGG + Intergenic
974265120 4:59577229-59577251 CACCATGATTGTAAGTTTACTGG + Intergenic
974577984 4:63753841-63753863 CACCATGATTGTGAATTTCCTGG - Intergenic
974751046 4:66141857-66141879 CACCATTATTGCAATTTTTCTGG - Intergenic
974832765 4:67210090-67210112 TGCAATGATTGTAAGTTTCCTGG + Intergenic
974864585 4:67564595-67564617 CTCCAGGATTGTATGATTCCTGG - Intronic
975040559 4:69740314-69740336 CACCATGATTGTAAGTTTCCTGG - Intronic
975301559 4:72796976-72796998 TGTCATGATTGTAAGTTTCCTGG - Intergenic
975361165 4:73474102-73474124 CACCATGATTGTGAGTTTCCAGG - Intergenic
975684516 4:76906461-76906483 CACCATGATAGGAAGCTTCCTGG - Intergenic
975956454 4:79846182-79846204 ATCTATATTTGCAAGTTTCCTGG + Intergenic
976069976 4:81230376-81230398 GGCCATGATTGTAAGTCTCCTGG + Intergenic
977108000 4:92915031-92915053 GGCCATGATTGTAAGTTTCATGG - Intronic
977858572 4:101927154-101927176 CGCCATGATTGTAAGTTTCCTGG - Intronic
977978064 4:103290128-103290150 ATGCATCATTGAAAGTTTCCAGG + Intergenic
978339317 4:107705463-107705485 CGCCATGATTATAAGTTTCCTGG + Intronic
978627996 4:110709335-110709357 TGCCATGATTGCAAGCTTCCTGG + Intergenic
978849860 4:113321515-113321537 CTCAATGATTCTCAGTTTCCTGG + Intronic
979306776 4:119155032-119155054 TGCCATGAGTGGAAGTTTCCAGG - Intronic
979346532 4:119593840-119593862 TGCCATGATTGTAAGTTTCCTGG - Intronic
979373365 4:119915434-119915456 TGCCATGATTGTAAGTTTCCTGG - Intergenic
979984243 4:127295135-127295157 CACTATAATTGCAAATTTCCTGG - Intergenic
980306552 4:131068103-131068125 TGCCATGATTGAAAGTTTCCTGG + Intergenic
980346731 4:131632220-131632242 TTCTCTGATTGTAAGTTTCCTGG + Intergenic
980369602 4:131850132-131850154 CTCAATGATTTCAATTTTCCTGG + Intergenic
980426959 4:132637668-132637690 CACCATGATTGTAAGCTTCCTGG + Intergenic
980532696 4:134074700-134074722 TACCATGATTGTAAGTTTTCTGG - Intergenic
981407053 4:144384549-144384571 TGCCATTATTGTAAGTTTCCTGG - Intergenic
981409895 4:144417639-144417661 CACCATGACTGTAAGTTTCCCGG - Intergenic
981912335 4:149995807-149995829 TTTCATGATTGGAAGCTTCCTGG + Intergenic
982034336 4:151330976-151330998 TGCCATGATTTTAAGTTTCCTGG - Intergenic
982307099 4:153944129-153944151 TGCCATGATTGTAAGCTTCCTGG - Intergenic
982803759 4:159736723-159736745 CGCCATGATTGTAATTTTCCTGG + Intergenic
982855475 4:160376911-160376933 CATCATGATTGGAAGCTTCCTGG - Intergenic
983067526 4:163228450-163228472 CACCATGACTGTAAGTTTTCTGG + Intergenic
983112123 4:163764627-163764649 CTTCAAGGTTTCAAGTTTCCTGG + Intronic
983908262 4:173206850-173206872 CACCTTGGTTGCAAGTTTCATGG - Intronic
984591904 4:181626495-181626517 CGCCATGATTGTAACTTTCCTGG - Intergenic
985223138 4:187729852-187729874 CACCATGATTGGAAGCTTCCTGG - Intergenic
986106750 5:4667090-4667112 GGCCATGATTGTAAGTTTCCTGG - Intergenic
986185931 5:5438092-5438114 TGCCATGATTATAAGTTTCCTGG - Intronic
986470888 5:8073184-8073206 CCCCATGATTGTACGTTTCCTGG - Intergenic
986723029 5:10573630-10573652 TGCCATGATTGTAAGTTTCCTGG - Intronic
986806046 5:11309953-11309975 TGCCATTATTGTAAGTTTCCTGG + Intronic
987166637 5:15204754-15204776 CACCATGATTGTAAGTTTCCAGG + Intergenic
987430298 5:17824798-17824820 TACCATGATTGTAAGTTTCCTGG - Intergenic
987835490 5:23155362-23155384 TGCCATGATTGTAAGTTTCCCGG + Intergenic
987835636 5:23157387-23157409 CACCATGATTGTAAGTTTCCTGG - Intergenic
988226974 5:28425497-28425519 GGCCATGATTGTAAGTTTCCTGG + Intergenic
988237556 5:28564849-28564871 TGCCATGACTGTAAGTTTCCTGG + Intergenic
988345620 5:30034745-30034767 CTGCATGATTGTAAGTTTCCTGG + Intergenic
989144355 5:38234113-38234135 TGCCATGATTGTAAGTTTCCTGG + Intergenic
989193040 5:38689828-38689850 TGCCATAATTGTAAGTTTCCTGG + Intergenic
990235666 5:53764957-53764979 CACCGTGATTGGAAGCTTCCTGG - Intergenic
990886571 5:60601087-60601109 TGCCATGATTGTAAGTTTCCTGG + Intronic
991120471 5:63007929-63007951 TGCCACGATTGTAAGTTTCCTGG - Intergenic
991222803 5:64235863-64235885 CACCATGATTGCAAGTTTCCTGG + Intronic
991223087 5:64237912-64237934 CTCCATGATTGCAAGTTTCCTGG + Intronic
991249192 5:64541140-64541162 TGCCATGATTGTAAGCTTCCTGG - Intronic
991259739 5:64653714-64653736 TTCCATGATTGTAAGCTTCCTGG + Intergenic
992247344 5:74839460-74839482 TGCCATGATTGCAAGTTTCCTGG + Intronic
993340757 5:86722570-86722592 CGCCATGATTGTAAGCTTCCTGG - Intergenic
993813448 5:92511118-92511140 CACCATAATTGGAAGCTTCCTGG - Intergenic
993967313 5:94373488-94373510 CACCAAGATTGTAAGTTTCCTGG - Intronic
994226323 5:97254983-97255005 CACCAGGATTGGAACTTTCCAGG - Intergenic
994425332 5:99577532-99577554 CACTATGATTGTAAGTTTCCTGG + Intergenic
994436008 5:99734703-99734725 CACTATGATTGTAAGTTTCCTGG - Intergenic
994464291 5:100107837-100107859 TGCCATGATTCTAAGTTTCCTGG + Intergenic
994941515 5:106329495-106329517 CACCATGATTGTAAGCTTACTGG + Intergenic
995283692 5:110363080-110363102 TACCATGATTGTAAGCTTCCTGG - Intronic
996615408 5:125435607-125435629 CGCCATGACCGGAAGTTTCCTGG - Intergenic
996683949 5:126258983-126259005 CACCATGATTGTAAGTTTCCTGG + Intergenic
997101655 5:130975961-130975983 CTGCATGATTCCTAATTTCCAGG + Intergenic
997110284 5:131066967-131066989 AGCCATGATTGTGAGTTTCCTGG + Intergenic
997925562 5:138027933-138027955 CACTATGATTGTAAGTTTCCTGG + Intronic
999605752 5:153313895-153313917 CTTAATGGTTTCAAGTTTCCAGG + Intergenic
1000239129 5:159392933-159392955 CACCATGATTGTAAGTTCCCTGG + Intergenic
1000659373 5:163919409-163919431 TGCCATGATTGTAAGTTTCCTGG + Intergenic
1001552153 5:172610928-172610950 GCCCATGATTGCAGGTTTCCTGG + Intergenic
1002679881 5:180953085-180953107 TGCCATGATTGTAAGTTTCCTGG - Intergenic
1003032753 6:2616703-2616725 TGCCTTGATTGTAAGTTTCCTGG + Intergenic
1004450878 6:15745085-15745107 CACCATGATTCTAAGTTTCCTGG + Intergenic
1005556862 6:26994899-26994921 TGCCATCATTGTAAGTTTCCTGG - Intergenic
1005846910 6:29788904-29788926 TGCCATGATTGTAAGTTTCATGG + Intergenic
1005851228 6:29824184-29824206 TGCCATGATTGTAAGTTTCCTGG + Intergenic
1005858607 6:29884116-29884138 TGCCATGACTGTAAGTTTCCTGG + Intergenic
1005863746 6:29922646-29922668 TGCCATGATTGTAAGTTTCCTGG + Intergenic
1005866159 6:29938943-29938965 TGCCATGACTGTAAGTTTCCTGG + Intergenic
1005984880 6:30865286-30865308 CACCGTGATTGAAAGCTTCCTGG - Intergenic
1006266575 6:32930497-32930519 CTCCATGATTGCACTTGTACAGG + Intergenic
1007044680 6:38760806-38760828 TACCATGATTGTAAGCTTCCTGG + Intronic
1007710265 6:43818418-43818440 CTCCATGTTTGCAAGGTGACTGG + Intergenic
1008190852 6:48454888-48454910 CTCCAGGACTACAAGTTTCCTGG - Intergenic
1008357583 6:50572919-50572941 CACCATAATTGTAAGTTTCCTGG - Intergenic
1008691414 6:53983390-53983412 CACCATGACTGGAAGCTTCCAGG - Intronic
1009042126 6:58191259-58191281 CTCCCTAATCGCAAGTTCCCAGG + Intergenic
1009983105 6:70749113-70749135 CGCCATAATTATAAGTTTCCTGG - Intronic
1011252994 6:85392710-85392732 CGCCATGATCGTAAGTTTCCTGG + Intergenic
1011879150 6:92001721-92001743 TGCCATGATTGTAAGTTTCCTGG + Intergenic
1012511705 6:100010071-100010093 TGCCATGATTGTAAGTTTCCTGG - Intergenic
1012708004 6:102558971-102558993 CACCATGATTGTAAGTTTCCTGG - Intergenic
1012906071 6:105067516-105067538 CTTCATGATTTCCAATTTCCTGG - Intronic
1013394197 6:109718073-109718095 TGCCATAATTGTAAGTTTCCTGG - Intronic
1014587117 6:123212487-123212509 CACCATGATTGGAAGCTTCCTGG - Intergenic
1014668541 6:124271155-124271177 TGCCATGATTGTAAGTTTCCTGG + Intronic
1015480457 6:133702722-133702744 TGCCATGATTGTAAGTTTCCTGG - Intergenic
1015522608 6:134146845-134146867 CCCCATGATTGTAGGTTTCCTGG - Intergenic
1015522633 6:134146977-134146999 CGCCATGATTGTAGGTTTCCTGG - Intergenic
1015966523 6:138699591-138699613 CACCATGATTGTAAGCTTCCTGG + Intergenic
1016172117 6:141031199-141031221 CACCATGATTGTAAGTTTCCTGG - Intergenic
1016199538 6:141391389-141391411 TGCCATTATTGTAAGTTTCCTGG + Intergenic
1016487281 6:144555336-144555358 CACCATGATTTTAAGTTTCCTGG - Intronic
1016589380 6:145728072-145728094 TGCCATGTTTGTAAGTTTCCTGG + Intronic
1016701088 6:147055032-147055054 GTCCAGGATTCCAAGATTCCAGG - Intergenic
1017178920 6:151531745-151531767 TGCCATGATTGTAAGTTTCCTGG - Intronic
1018347869 6:162921516-162921538 CTCCATGTTTCAAAGTTCCCTGG - Intronic
1019931178 7:4224316-4224338 TGCCATGATTGGAAGCTTCCTGG - Intronic
1020103494 7:5408757-5408779 CTCCAGAATTGCTGGTTTCCTGG - Intronic
1020366346 7:7384727-7384749 CCCAATGATATCAAGTTTCCTGG - Intronic
1020402790 7:7797114-7797136 TGCCATGATTGTAAGCTTCCTGG - Intronic
1020578917 7:9970323-9970345 CGCCATAATTGTAAGTTTTCTGG + Intergenic
1021117352 7:16759319-16759341 TGCCATGATTGTAAGCTTCCTGG - Intronic
1021763064 7:23920164-23920186 TGCCATGATTGTAAGTTTCCTGG + Intergenic
1021878987 7:25075747-25075769 CTCCATGTTTGAAACTTTCTAGG - Intergenic
1021903628 7:25312026-25312048 CGCCATGATTGTAAGTTTCCTGG + Intergenic
1022185762 7:27966837-27966859 CTGCTTCATTGCAAGTTACCAGG - Intronic
1022613697 7:31905995-31906017 CCCCATGATTGTAAGTTTCCTGG + Intronic
1023019608 7:35998845-35998867 CGCCATGATTGTAAGTTTCCTGG + Intergenic
1023527405 7:41119014-41119036 TGCCATAATTGTAAGTTTCCTGG - Intergenic
1023564614 7:41511422-41511444 CTCCATGCTTTCCAGCTTCCTGG - Intergenic
1023795109 7:43785520-43785542 CTTCAGCCTTGCAAGTTTCCTGG - Intronic
1026354330 7:69544296-69544318 CACTATGATTGTAAGTTTCCTGG + Intergenic
1026502381 7:70953701-70953723 CGCCATGGTTGTAACTTTCCTGG - Intergenic
1026611674 7:71865382-71865404 CGCCATGACTGTACGTTTCCTGG + Intronic
1027600747 7:80237694-80237716 TTCCATGATTCTAAGTATCCTGG - Intergenic
1028879948 7:95868921-95868943 CTCCACGACTGGATGTTTCCTGG + Intronic
1029219904 7:98980342-98980364 CTCTATGATGGGAAGTTTACAGG - Intronic
1029232762 7:99085045-99085067 CACCATGGTTGAAAGTTTCCTGG + Intronic
1029616681 7:101663634-101663656 CACCATGATTGTAAGTTTCCTGG + Intergenic
1030039576 7:105437562-105437584 TGCCATGACTGTAAGTTTCCTGG + Intergenic
1031647129 7:124240206-124240228 CTACATGATTGCTATATTCCTGG - Intergenic
1032308802 7:130762172-130762194 ATCCATGATTCCAAGTTACAGGG - Intergenic
1032618526 7:133501739-133501761 GTTCATGATTCCTAGTTTCCTGG + Intronic
1033131574 7:138749829-138749851 ATCCATGATTCCAAGATTCTAGG - Intronic
1033953470 7:146813988-146814010 CATCATAATTGTAAGTTTCCTGG + Intronic
1034121637 7:148633285-148633307 TGCCATGATCGTAAGTTTCCTGG + Intergenic
1034134308 7:148751592-148751614 CTCCTTGAGTACAAGTTTCTTGG - Intronic
1034321172 7:150183988-150184010 CGCCATAATTGTAAGTTTCCTGG + Intergenic
1034771576 7:153783276-153783298 CGCCATGATTGTAAGTTTCCTGG - Intergenic
1036384348 8:8265573-8265595 CACCATGATTGTAAGTTTCCTGG - Intergenic
1037345132 8:17890725-17890747 CACCACGACTGTAAGTTTCCTGG - Intronic
1037647720 8:20808641-20808663 TGCCATGACTGTAAGTTTCCTGG + Intergenic
1037660381 8:20921094-20921116 TACCATGATTGTAAGTTTCCTGG - Intergenic
1038437584 8:27546921-27546943 TGCCATGATTGTAAGTTTTCTGG - Intergenic
1038739983 8:30208580-30208602 CGCCATGATTGTAAGCTCCCTGG + Intergenic
1038939366 8:32286696-32286718 CACCATGAGTAGAAGTTTCCTGG + Intronic
1039313640 8:36347697-36347719 TGCCATGATTGTAAGTTTCCTGG - Intergenic
1039652022 8:39352562-39352584 TGCCATGATTGTAAGTGTCCTGG + Intergenic
1040107825 8:43550210-43550232 CTCCAGGCTTGCAAGCTTTCAGG - Intergenic
1041852218 8:62404610-62404632 CACCATGATTTTAAGTTTCATGG + Intronic
1042247509 8:66722798-66722820 TGCAATGATTGCAAGCTTCCTGG - Intronic
1042375743 8:68050350-68050372 CACCATGATTTTAAGTATCCTGG - Intronic
1042376390 8:68057247-68057269 TGCCATGATTGTAAGTTTCCTGG + Intronic
1043022778 8:75024885-75024907 CTCCATGATTCCAAGTGCTCAGG - Intronic
1043602165 8:81953765-81953787 TTCCATGATTCTAAGTTTCTAGG - Intergenic
1043617847 8:82149217-82149239 TGCCATGATTGTAAGTTTCCGGG + Intergenic
1044326786 8:90868135-90868157 TACCATAATTGTAAGTTTCCTGG + Intronic
1046145921 8:110158479-110158501 CACCATGATTGTAAGTTTCCTGG + Intergenic
1046280614 8:112024626-112024648 CTCAATGATTTCAAATATCCAGG + Intergenic
1046666630 8:117010750-117010772 CACCATGATTGGAAGCTTCCCGG - Intronic
1048882727 8:138883764-138883786 CTCCATAACTGTAAGTTCCCTGG + Intronic
1049296251 8:141841261-141841283 CGCCATGCTTGTAAGTTTCCTGG + Intergenic
1049946755 9:604529-604551 CACCGTGATTATAAGTTTCCTGG + Intronic
1050383516 9:5058306-5058328 TGCCATGATTTTAAGTTTCCTGG - Intronic
1050674665 9:8037921-8037943 CCCCATAATTGTAAGTTTCCTGG - Intergenic
1050720613 9:8584827-8584849 CAACGTGATTGTAAGTTTCCTGG - Intronic
1050721391 9:8594723-8594745 TGCCATGATTCTAAGTTTCCTGG + Intronic
1050822766 9:9901781-9901803 TGCCATGATTGTAAGTTTCCTGG - Intronic
1051285443 9:15491811-15491833 TGCCATGATTGTAAGTTTCTTGG - Intronic
1051990241 9:23144571-23144593 TGCCATGATTGTAAGTTTCCTGG - Intergenic
1053084661 9:35208544-35208566 CACCATGATTGTAGGTTTCCTGG - Intronic
1053633977 9:39975792-39975814 CTCAATGATTTCAGTTTTCCTGG + Intergenic
1053771768 9:41487712-41487734 CTCAATGATTTCAGTTTTCCTGG - Intergenic
1054209910 9:62274905-62274927 CTCAATGATTTCAGTTTTCCTGG - Intergenic
1054315084 9:63574049-63574071 CTCAGTGATTTCAATTTTCCTGG + Intergenic
1054732149 9:68712251-68712273 CGCCATGACTGTAAGCTTCCTGG + Intronic
1054843619 9:69769515-69769537 CTCCATGATCGTAAGCTCCCTGG - Intergenic
1054901902 9:70377815-70377837 CACCATGATTGAAAGTTTTCTGG + Intergenic
1054919087 9:70523931-70523953 TGCCGTGATTGTAAGTTTCCTGG - Intergenic
1055751700 9:79513794-79513816 TGCCATGATTGGAAGCTTCCTGG - Intergenic
1055861612 9:80756956-80756978 CACCATGATTGTAAGTTCCCTGG - Intergenic
1056477516 9:86967307-86967329 CACCATGTTTGTAAGTTTTCTGG + Intergenic
1056906157 9:90649719-90649741 CTGCATGATCGAAAGTGTCCTGG - Intergenic
1058311157 9:103504634-103504656 CTCTATTATAGCAAGTTTCCAGG + Intergenic
1058374118 9:104304000-104304022 CACAATGATTTAAAGTTTCCTGG + Intergenic
1058798573 9:108522211-108522233 CACCATGATAGTAAGTTTCCTGG - Intergenic
1058852549 9:109026915-109026937 CACCATGATTGGAAGTTTCCTGG + Intronic
1058987921 9:110225867-110225889 CACCAGGATTGTAAGTTTCCTGG + Intergenic
1059260344 9:112970203-112970225 CTCCATAATTGTTAGTTTCCTGG - Intergenic
1060436044 9:123594010-123594032 TACCATGATTGCAAGTTTCCTGG + Intronic
1060789604 9:126477104-126477126 CACCATGACTGGAAGCTTCCTGG - Intronic
1061930529 9:133830556-133830578 CACCATGACTATAAGTTTCCTGG + Intronic
1186146139 X:6626042-6626064 TGCCATGATTGTAAGTTTCTTGG - Intergenic
1186379037 X:9037565-9037587 CACCATAATTGTAAGTTTCCCGG - Intronic
1186989802 X:15055275-15055297 TGCCATGATTGTAAGTTTCCTGG + Intergenic
1187091214 X:16098766-16098788 TGCCATGATTGTAAGCTTCCAGG + Intergenic
1187227291 X:17385885-17385907 CTCTATGATTCCAAGATTCTAGG - Intronic
1187235181 X:17460358-17460380 CACCATGATTTTAAGTTTCCTGG - Intronic
1188662488 X:32776493-32776515 CACCATGATTGTAAGTTTCCTGG - Intronic
1188957171 X:36447593-36447615 TGCCATGATTGGAAGTTTCCTGG - Intergenic
1189011501 X:37049720-37049742 CACCATGATTGTAAGTTTCCTGG + Intergenic
1189355004 X:40303957-40303979 TGGCATGATTGTAAGTTTCCTGG + Intergenic
1190794294 X:53726488-53726510 CTCCATGATTGGGAGCTTCCTGG + Intergenic
1191122882 X:56924616-56924638 CACTATAATTGTAAGTTTCCTGG + Intergenic
1193655388 X:84190599-84190621 TGCCTTGATTGTAAGTTTCCTGG + Intergenic
1194039134 X:88918105-88918127 AGCCATGATTGTAAGTTTCCTGG - Intergenic
1194239335 X:91424178-91424200 CACCATGACTGTAAGTTTCTTGG + Intergenic
1194266572 X:91760900-91760922 CTCCTTTATTGCAAGTTTTGGGG + Intergenic
1194322355 X:92464489-92464511 CACCATGATGGTAAGTTTCATGG + Intronic
1194676279 X:96797561-96797583 TGCCATGATTGAAAGTTTCCTGG - Intronic
1194912115 X:99658422-99658444 CTCCTTGAACGCCAGTTTCCTGG - Intergenic
1195548372 X:106138751-106138773 TCCCATGATTGCAGTTTTCCTGG + Intergenic
1196060191 X:111399930-111399952 CTCCAAGATTTTAAGTTTCAGGG - Intronic
1196062908 X:111430600-111430622 CGCCATGATTGTAAGTTCCTGGG + Intergenic
1196156881 X:112439832-112439854 TGCCATGATTGGAAGCTTCCTGG + Intergenic
1197915616 X:131531022-131531044 CACCATGATACCAAATTTCCTGG + Intergenic
1198611578 X:138407237-138407259 TGCCATGATTGAAAGCTTCCTGG - Intergenic
1198948497 X:142041880-142041902 TACCATGACTGTAAGTTTCCTGG - Intergenic
1198991502 X:142520223-142520245 CACCCTGATTGTAAGTTTCCTGG - Intergenic
1199512497 X:148638294-148638316 CACCATGATTGTAACTTTCAGGG - Intronic
1199574410 X:149299579-149299601 CACCATGATTGCAACTTTCCTGG + Intergenic
1200583778 Y:4981814-4981836 CTCCTTTATTGCAAGTTTTGGGG + Intergenic
1200630512 Y:5577966-5577988 CACCATGATGGTAAGTTTCATGG + Intronic
1200668404 Y:6056906-6056928 CACCATGATGGTAAGTTTCTGGG - Intergenic
1201252622 Y:12074551-12074573 TACCATGATTGAAATTTTCCTGG + Intergenic
1201977621 Y:19869776-19869798 CTCCAGGTTTGCGAGCTTCCCGG - Intergenic