ID: 991226661

View in Genome Browser
Species Human (GRCh38)
Location 5:64281338-64281360
Sequence TTGACTAGGCATGATGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991226658_991226661 11 Left 991226658 5:64281304-64281326 CCTGATTGCTCTGGCTAGGACTT 0: 500
1: 1485
2: 2479
3: 9378
4: 9649
Right 991226661 5:64281338-64281360 TTGACTAGGCATGATGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991226661 Original CRISPR TTGACTAGGCATGATGAGAA TGG Intronic
No off target data available for this crispr