ID: 991232042

View in Genome Browser
Species Human (GRCh38)
Location 5:64345271-64345293
Sequence TGTGCACTGCGGAGCTCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 248}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991232042_991232044 -3 Left 991232042 5:64345271-64345293 CCTCTGGAGCTCCGCAGTGCACA 0: 1
1: 0
2: 3
3: 30
4: 248
Right 991232044 5:64345291-64345313 ACAGCAGAAGTGTCCGTATATGG 0: 1
1: 0
2: 0
3: 3
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991232042 Original CRISPR TGTGCACTGCGGAGCTCCAG AGG (reversed) Intronic
900073796 1:795470-795492 TGTGCAGTGAAGTGCTCCAGAGG + Intergenic
900411362 1:2514173-2514195 TTTGCACTGCCGGGCTCCTGAGG - Intronic
900686764 1:3953806-3953828 TGGGCACTGCGGGCTTCCAGGGG - Intergenic
901701047 1:11044914-11044936 TGGGCAGGCCGGAGCTCCAGGGG + Intronic
901850489 1:12011875-12011897 TGTGCAATGCTGAGATCCTGAGG - Exonic
903240656 1:21980727-21980749 TGTGCACTGTGCAACTCTAGAGG - Intronic
903244399 1:22005350-22005372 TGTGCACTGTGCAACTCTAGAGG - Intronic
905367814 1:37464621-37464643 TGTGAACTGCACAACTCCAGAGG + Intergenic
905925929 1:41749790-41749812 TGTGCTCTACGGAGCTCCGGGGG + Intronic
906119281 1:43377508-43377530 TGAGCACAGGGGAGCTGCAGAGG + Intergenic
906154033 1:43603650-43603672 TGAACACTGCGCTGCTCCAGTGG + Exonic
906605132 1:47164008-47164030 TGTTCCCTGCAGAGCTCTAGGGG + Intergenic
907155560 1:52330628-52330650 TGAGCAGTGAGGACCTCCAGTGG + Intronic
907573322 1:55504095-55504117 TGTGCACTGCACAACTCTAGGGG - Intergenic
909585624 1:77284220-77284242 TGTGCTATGCGCAGCTCAAGAGG + Intronic
910602191 1:89043715-89043737 TGTGCACCACCGAGCACCAGAGG - Intergenic
912388391 1:109284282-109284304 TGAGGACTGAGGACCTCCAGAGG - Intergenic
913681575 1:121190926-121190948 TGTGCCCTGAGGAACTCCTGAGG + Intronic
914033410 1:143978563-143978585 TGTGCCCTGAGGAACTCCTGAGG + Intergenic
914156035 1:145089408-145089430 TGTGCCCTGAGGAACTCCTGAGG - Intronic
916942473 1:169690147-169690169 TGTGCACTGTACACCTCCAGGGG + Intronic
917891917 1:179447864-179447886 TGGTCTCTGAGGAGCTCCAGGGG + Intronic
919290535 1:195624025-195624047 TGTACCCTGCAGAGCTGCAGGGG + Intergenic
919827222 1:201511930-201511952 TTTACACTGTGAAGCTCCAGGGG + Intergenic
920101992 1:203522465-203522487 TGGGGGCCGCGGAGCTCCAGAGG - Intergenic
920468891 1:206209444-206209466 TGTGCCCTGAGGAACTCCTGAGG + Intronic
920766854 1:208841811-208841833 GGTGCTCTGCGGAGCTGCACAGG + Intergenic
922269655 1:224020378-224020400 TGTGCAGTGAAGTGCTCCAGAGG + Intergenic
1062770440 10:96192-96214 TGTGCCCTGCAGAGCCACAGGGG - Intergenic
1063449400 10:6141273-6141295 TGAGCACTGCTGTGCTCCAGAGG - Intergenic
1065999518 10:31091370-31091392 TGTGCACTGCCCAACTTCAGGGG - Intergenic
1066264132 10:33758815-33758837 TGTGCACTGCGCAACTCCATGGG + Intergenic
1067218853 10:44326874-44326896 TGAGCACTGCTGGGCTCTAGTGG + Intergenic
1067926347 10:50512519-50512541 TGTGCACAGAGGGACTCCAGAGG - Intronic
1069109222 10:64424531-64424553 TGTGCACTACACAGCTCCATGGG + Intergenic
1069948965 10:72006533-72006555 TGTGTACTGCTCAACTCCAGGGG + Intronic
1070568364 10:77620869-77620891 TGTGCACTGCACAACTCCAGAGG + Intronic
1070683775 10:78466994-78467016 TGTGCACTACCCAACTCCAGGGG - Intergenic
1071016213 10:80999806-80999828 TATGGACTACTGAGCTCCAGTGG - Intergenic
1071260915 10:83918305-83918327 TATGCATTGCCCAGCTCCAGTGG + Intergenic
1072790303 10:98312874-98312896 GGTGGACTGCGGAGGGCCAGAGG - Intergenic
1077590609 11:3488137-3488159 TGTGCATTGCATACCTCCAGGGG + Intergenic
1079436551 11:20459298-20459320 TGTGTACTGCACAACTCCAGAGG + Intronic
1080975357 11:37333235-37333257 TGGGCACAGCGGATTTCCAGTGG + Intergenic
1081539121 11:44017336-44017358 TGTGCACTGCACAACTCCAGGGG + Intergenic
1082693923 11:56336982-56337004 TGTGCATGGAAGAGCTCCAGTGG + Intergenic
1084164863 11:67370904-67370926 GAGGCACTGCAGAGCTCCAGAGG + Intronic
1084246329 11:67859918-67859940 TGTGCATTGCATACCTCCAGGGG + Intergenic
1084648409 11:70474046-70474068 AGTGCCCTGCGTAGCTACAGGGG - Intronic
1084826352 11:71734582-71734604 TGTGCATTGCATACCTCCAGGGG - Intergenic
1085270900 11:75269266-75269288 TGGTCACTGCGGGGCTCCAGAGG + Intronic
1085521841 11:77143712-77143734 TGTGCCCTGCGGTGTGCCAGGGG + Intronic
1088763688 11:112956582-112956604 TGTGCACTGCACAGCTTCAAGGG - Intergenic
1089354572 11:117841279-117841301 TGTGCACTGCCCAGGTCTAGGGG - Intronic
1089403947 11:118181903-118181925 TGTGCTCTGCAGATCACCAGAGG - Intergenic
1090335185 11:125957311-125957333 TGTGCACAGGGGAGTTTCAGGGG + Exonic
1091539743 12:1448933-1448955 TGTGCCCTGCAGAGCCACAGGGG + Intronic
1091805158 12:3350647-3350669 TGTGCACTGCACAATTCCAGGGG - Intergenic
1092416897 12:8297041-8297063 TGTGCATTGCATACCTCCAGGGG + Intergenic
1093563392 12:20571424-20571446 TGTGCGCTGCACAACTCCAGGGG - Intronic
1094498061 12:31001671-31001693 TGTGCTTTGCTGAGCACCAGTGG + Intergenic
1094682224 12:32677021-32677043 TGTGCACTACGCAACTCCAGTGG - Intergenic
1095623471 12:44285055-44285077 TGGGCACTGCAGAACTCCAGGGG + Intronic
1096436021 12:51591475-51591497 AGTGCGCGGCGGGGCTCCAGGGG + Intronic
1096535871 12:52274384-52274406 TGGGCACTGGGGAGCCACAGAGG - Intronic
1099978645 12:89572505-89572527 TGTGCACTGGGAAGAGCCAGAGG - Intergenic
1101728189 12:107405171-107405193 TGTACACTGCTCAGCTCTAGAGG + Intronic
1101734712 12:107454357-107454379 TGTGCAGTGCAGAGCACCCGTGG - Intronic
1103707018 12:122880924-122880946 TGTGCACTGCCCAACTCCAGGGG + Intronic
1103739381 12:123081180-123081202 TGTCCACAGCCTAGCTCCAGAGG + Intronic
1105773978 13:23639489-23639511 TGTGCACAGCAGGGCTCCTGAGG - Intronic
1106434801 13:29714013-29714035 TGTGCACTGCTGCACTCTAGTGG + Intergenic
1108020632 13:46124686-46124708 GGTGCACTGCGGGGATGCAGAGG - Intergenic
1108274126 13:48790729-48790751 TGGGCACTGCACAACTCCAGGGG + Intergenic
1110706982 13:78608007-78608029 TTGGCACTGCGGAGCTCCCTCGG + Intergenic
1111040478 13:82740778-82740800 TGTGCAAAGGGCAGCTCCAGTGG - Intergenic
1111218763 13:85178411-85178433 TGTGCTCTGCAGAGCTACAGAGG - Intergenic
1111323664 13:86663656-86663678 TGTACCCTGCAGAGCTACAGGGG - Intergenic
1111799939 13:92969015-92969037 TGTTCATAGCGCAGCTCCAGTGG + Intergenic
1112201549 13:97281269-97281291 TGTCCACTGCACAACTCCAGGGG - Intronic
1112581590 13:100680717-100680739 TGTGCCCTGCCCAACTCCAGAGG - Intergenic
1113082696 13:106535090-106535112 GGCGCGCTGCGCAGCTCCAGCGG + Exonic
1115716583 14:36112145-36112167 TGAGCACTGGAGAGCTGCAGAGG - Intergenic
1116283760 14:42945744-42945766 TGTTCACTGGGCAGCTCTAGTGG + Intergenic
1119652941 14:76396682-76396704 TGTGCACTGCAGGGGACCAGGGG - Intronic
1119863810 14:77956512-77956534 TGTGAAGTGGGGAGATCCAGTGG - Intergenic
1121359731 14:93245725-93245747 TGGGCACTGCTGAGTCCCAGTGG + Intronic
1123019347 14:105390363-105390385 TGAGCACTGGGAAGCTCCCGGGG - Intronic
1124445035 15:29722778-29722800 TGTGCCCTGCGTGGCTACAGGGG + Intronic
1125407613 15:39369874-39369896 TGTGCCCTGCAAAGCTTCAGGGG - Intergenic
1125766290 15:42138725-42138747 TGTGCACTGCACAACTTCAGGGG - Intergenic
1129098650 15:73236866-73236888 TGTGGGCTGCGGAGCTCCAGGGG + Intronic
1129944408 15:79526651-79526673 TGTGTCCTGCGCTGCTCCAGTGG - Intergenic
1130103848 15:80914463-80914485 TGTGCCCTGCACTGCTCCAGGGG + Intronic
1131726775 15:95235002-95235024 TGTGCCCTGCAGAGCCACAGGGG - Intergenic
1133271222 16:4611723-4611745 TGGGAACTGAGGAGCCCCAGAGG + Intronic
1136035465 16:27536565-27536587 TATTGACTGCGGATCTCCAGGGG - Intronic
1137393072 16:48097607-48097629 TGGGGAATGCGGAACTCCAGGGG - Intronic
1137463170 16:48684256-48684278 TGTGCCCTGCAGAACCCCAGTGG - Intergenic
1137614232 16:49837414-49837436 TGTGCACTGTGTGGTTCCAGAGG - Intronic
1137813564 16:51376260-51376282 TGTGCACTGCACAACTCCAGGGG + Intergenic
1141664708 16:85460030-85460052 TGTGCACTGCGGGGCCCTGGGGG - Intergenic
1141915862 16:87096627-87096649 TGGGCGCTTCGGAGCCCCAGTGG + Intronic
1143089189 17:4438769-4438791 TGTGCACTGAGCAGCGACAGGGG + Intronic
1143389786 17:6553510-6553532 TGTGCACTGCACAACTCCAGGGG + Intronic
1143876498 17:9995061-9995083 TGAGCACTGGGGAGCAGCAGGGG + Intronic
1145188505 17:20817650-20817672 TGTGCACTGCACAACTCCAAGGG - Intergenic
1146639343 17:34528048-34528070 TGTGCACTGCAGAACTTTAGGGG - Intergenic
1147718150 17:42521824-42521846 TGTGCACTGCGGAGCAGCCAAGG - Exonic
1147842049 17:43378858-43378880 TGTGAAGAGCGGAGCTTCAGCGG + Intergenic
1149064722 17:52466065-52466087 TGTGCCCTGCAAAGCTACAGGGG + Intergenic
1152118647 17:78404497-78404519 TTTGAACTCCGGAGCTCAAGTGG + Intronic
1152645903 17:81468392-81468414 TGTGCCCTGCAGGGCTCCTGGGG - Intergenic
1153816298 18:8793155-8793177 TGTGAACTGCAGAGCCCCAAAGG + Intronic
1154133892 18:11759723-11759745 AGTGCCATGCAGAGCTCCAGCGG + Intronic
1155307381 18:24492108-24492130 TGTGCAGAGCGGAGCTGGAGTGG - Intergenic
1156001321 18:32387939-32387961 TGTGCACTGCCCAACTCCAAGGG + Intronic
1157410672 18:47460371-47460393 TGGGCACTGAGGAACTCCTGGGG + Intergenic
1157622001 18:49021984-49022006 TGTGCACTGCTTAACTGCAGAGG + Intergenic
1158573010 18:58612649-58612671 TGTGCCCTGCAAAGCTCCAGTGG - Intronic
1160090057 18:75818556-75818578 AGTTCACTGCAAAGCTCCAGGGG + Intergenic
1161018639 19:1997199-1997221 TGTGCAATGAGGGGTTCCAGAGG - Intronic
1161256444 19:3312649-3312671 TGTGCACAGCTGAGTCCCAGGGG + Intergenic
1162401937 19:10451740-10451762 GGTGCACTGCACAACTCCAGGGG + Intronic
1162729595 19:12710435-12710457 CTTGCACTGTGGGGCTCCAGGGG + Intronic
1165055419 19:33173460-33173482 TGTGCACAGAGAGGCTCCAGCGG - Intronic
1165766056 19:38352011-38352033 TGTGCACTGCCCAACTCCAGGGG + Intronic
1168516316 19:57013034-57013056 TGTGCATTGCACAACTCCAGGGG + Intergenic
926275289 2:11398992-11399014 TGAGCCCTGCAGAGCCCCAGAGG + Intergenic
927194984 2:20540790-20540812 GGTGCCCTGGGGAGCTCCAGGGG + Intergenic
929226446 2:39516005-39516027 TCTGCACTGCAGAACTGCAGTGG + Intergenic
929311721 2:40433572-40433594 TGTGCATTGCACATCTCCAGGGG - Intronic
931198787 2:60077311-60077333 TGTGCCCAGGGAAGCTCCAGAGG - Intergenic
931686924 2:64801761-64801783 TGTGCACTGCACAACTCCAGAGG - Intergenic
933383110 2:81576169-81576191 TGTGCACTGCACAACTCTAGGGG + Intergenic
934637782 2:96006856-96006878 TGTGCTCTGCACAGCTCCAGGGG + Intergenic
934795879 2:97098555-97098577 TGTGTTCTGCACAGCTCCAGGGG - Intergenic
935694317 2:105757845-105757867 TGTGCACTGAAGAGCTTCTGAGG - Intronic
937095844 2:119234715-119234737 TGTGCACTGCACGCCTCCAGAGG + Intronic
938066094 2:128282784-128282806 TGGGCACTGCGGAGGAGCAGAGG + Intronic
938102826 2:128509354-128509376 TGTACACTGCACAACTCCAGGGG - Intergenic
939460145 2:142488535-142488557 TGTGACCCCCGGAGCTCCAGAGG - Intergenic
939623728 2:144451019-144451041 TGTCCACTCCGGAGACCCAGGGG - Intronic
941227172 2:162864799-162864821 TGTGCTCTGCAGAGCCACAGGGG - Intergenic
945593102 2:211758763-211758785 TGTGCACTGCACACCTCCAAGGG - Intronic
946729411 2:222694010-222694032 TGTGCACTGAACAACTCCAGGGG + Intronic
946729418 2:222694072-222694094 TGTGCACTACTGAACTCTAGAGG - Intronic
947559779 2:231138793-231138815 TGTGCGCTACGGAGCTGCAATGG + Exonic
948429821 2:237912239-237912261 AGTGCACTGAGGTGCTCCTGGGG + Intergenic
1169183322 20:3590433-3590455 TGTGCACTGCAGAACTCTAGGGG - Intronic
1169400401 20:5274607-5274629 AGTGAACTGGGGAGCTACAGGGG + Intergenic
1172951213 20:38724471-38724493 AGTGCACTGCGGAGCTGCCGCGG - Exonic
1173842437 20:46166608-46166630 TGAGCCCTGTGGAGCACCAGAGG - Intergenic
1174426647 20:50436370-50436392 CATGCACTGCCCAGCTCCAGGGG + Intergenic
1175187933 20:57191278-57191300 TGTGCTCTGGGGTGCTCCAGAGG + Intronic
1175200940 20:57277234-57277256 TGTGTACTGCACAACTCCAGAGG - Intergenic
1176142538 20:63551188-63551210 TGTTCACTGCTGGGCACCAGGGG - Intronic
1176299275 21:5090951-5090973 TGTGCCCTGTGGTGCTCCCGAGG + Intergenic
1178771460 21:35508619-35508641 TGTGCACTGCACAGCTCCAGGGG - Intronic
1179150458 21:38805158-38805180 TGGGCACCGCTCAGCTCCAGAGG + Intergenic
1179857751 21:44170996-44171018 TGTGCCCTGTGGTGCTCCCGAGG - Intergenic
1180889278 22:19274022-19274044 TGTGCAGTGCGGAGCTCCTAGGG - Intronic
1180935329 22:19621677-19621699 TGTGCCCTGTAGAGCTCCTGGGG + Intergenic
1182614657 22:31578858-31578880 TGTGCTTTGTGGAGCCCCAGAGG - Intronic
1183257979 22:36775476-36775498 AGGGCACTTCGCAGCTCCAGTGG - Intronic
1183785291 22:40025812-40025834 TCTGCACTGGGGAGCTACACTGG - Intronic
1185052594 22:48561667-48561689 TGGGCATCGCGGATCTCCAGTGG - Intronic
949433988 3:4008344-4008366 TGTACAGTGCACAGCTCCAGAGG + Intronic
949533029 3:4976319-4976341 TGTGCACCGCTCAACTCCAGGGG - Intergenic
950312500 3:11970747-11970769 TGTGCACTGCACAATTCCAGGGG - Intergenic
951039608 3:17974782-17974804 TGTACACTGCACAACTCCAGGGG - Intronic
954751489 3:52816711-52816733 AGTGCCCTCCGGAGCTGCAGGGG + Intronic
955392858 3:58533938-58533960 TGTGCACTGCAAAACTCCAGAGG - Intronic
955496304 3:59536759-59536781 TGTGCAAAGGTGAGCTCCAGAGG + Intergenic
956013053 3:64852122-64852144 TGTGTACTGCTAAGCTCCAGGGG - Intergenic
956964766 3:74445903-74445925 TGTGCACTGCACAACTCAAGAGG + Intronic
959083563 3:101827830-101827852 TGGGCACTGAGGAGGGCCAGAGG - Exonic
959719416 3:109470148-109470170 TGTGCCCTGCAAAGCTACAGGGG + Intergenic
961460046 3:127044392-127044414 TGTGCACTGCACAACTCCATGGG - Intergenic
961894444 3:130155643-130155665 TGTGCATTGCATACCTCCAGGGG + Intergenic
964150461 3:153518394-153518416 TGTACCCTGCAGAGCTACAGGGG - Intergenic
964641069 3:158911129-158911151 TGGGCACTGCCTAGCACCAGAGG + Intergenic
964719670 3:159758685-159758707 TGTACACTGCACAACTCCAGAGG + Intronic
966452524 3:180078280-180078302 TGTACCCTGCAGAGCTGCAGGGG - Intergenic
967091554 3:186138841-186138863 TGTGCACGGTGGAGCTACACGGG - Intronic
967689072 3:192452668-192452690 TGTGCACTGAACAACTCCAGAGG - Intronic
967711252 3:192710965-192710987 TTTTCACTGTGGAGCTCCTGAGG - Intronic
968288887 3:197523944-197523966 TGGGCACTGCCGAGCTGCTGGGG + Intronic
969748327 4:9091426-9091448 TGTGCATTGCACAACTCCAGGGG - Intergenic
969809359 4:9635986-9636008 TGTGCATTGCACAACTCCAGGGG - Intergenic
970635476 4:18005316-18005338 TGTACCCTGCGGAGCCACAGGGG - Intronic
971779659 4:31016491-31016513 TGTGCATTGAGCAACTCCAGGGG + Intronic
972262511 4:37424177-37424199 TGTGTACTGCAGAACTCCATGGG - Intronic
972809295 4:42564411-42564433 TGTACCCTGCAGAGCTACAGGGG + Intronic
974177702 4:58345248-58345270 TGTACACTGCAAAGCTACAGGGG + Intergenic
975239756 4:72043475-72043497 TGTGCCCTGCGAAGCCACAGGGG + Intronic
976782681 4:88778448-88778470 TGTGCACTGCAGTGGTCAAGAGG - Intronic
977033872 4:91924799-91924821 TGAGCACTGAGGAGCTTGAGTGG + Intergenic
977097889 4:92769311-92769333 TGTGCCCTGCAAAGCTACAGGGG - Intronic
977564004 4:98563050-98563072 TGTGCACTGCACAACTCCTGGGG + Intronic
977984011 4:103360605-103360627 TGTGCTCTGCAGAGCCACAGGGG + Intergenic
981325528 4:143442403-143442425 TGTGCTCTACAGAGCTCAAGGGG - Intronic
981503052 4:145473157-145473179 TGTACACTGCAGAGCCACAGGGG - Intergenic
982160545 4:152564578-152564600 TATGCACTGCACAGCTCCAGGGG + Intergenic
982810055 4:159814069-159814091 TGTGCAGTGAAGAGTTCCAGGGG + Intergenic
985698967 5:1358999-1359021 TGTGCACTGAGCAGCCCCATGGG + Intergenic
986564765 5:9100898-9100920 TGTGCACTGCAGAATTCCAAAGG - Intronic
986709750 5:10480214-10480236 TGTGTATTTCGTAGCTCCAGGGG - Intergenic
986785778 5:11112693-11112715 GGCACAGTGCGGAGCTCCAGAGG + Intronic
987076134 5:14383362-14383384 TGCTCACTGCCCAGCTCCAGGGG + Intronic
987196966 5:15536416-15536438 TGTGCCCTGCAGAGCGACAGAGG + Intronic
991232042 5:64345271-64345293 TGTGCACTGCGGAGCTCCAGAGG - Intronic
992563631 5:77976304-77976326 TTTGCCCTGCGGAGCTCCTGAGG + Intergenic
992956861 5:81918836-81918858 TGTGTACTGCGTAACTCTAGGGG - Intergenic
992957451 5:81924547-81924569 TGTGCACTGCCCAGCTCTGGAGG - Intergenic
996046702 5:118882307-118882329 TGTGCCCTGCAGAGCCACAGGGG - Intronic
996864512 5:128104854-128104876 TCTGCACTGTATAGCTCCAGAGG - Intronic
997579985 5:135011100-135011122 TGGGCACTAGGGAGCTACAGTGG + Intronic
1000117743 5:158169369-158169391 TATGCACTGCTCAGATCCAGTGG - Intergenic
1000969735 5:167700413-167700435 TGTACACTGCAGAACTCCAAGGG + Intronic
1002319759 5:178367988-178368010 TGTGCACTGCGGAAATGCACGGG + Intronic
1002543298 5:179920646-179920668 TTTGCTTTGAGGAGCTCCAGTGG - Intronic
1003142572 6:3483760-3483782 TGTGCACTGAGGAGGGACAGAGG - Intergenic
1005200879 6:23342751-23342773 TGGGGACAGCTGAGCTCCAGGGG + Intergenic
1005250170 6:23936501-23936523 TGTGCAATGCACAACTCCAGAGG + Intergenic
1005312553 6:24572299-24572321 TCTGCTCTGGAGAGCTCCAGGGG - Intronic
1007335745 6:41153914-41153936 TGTGGATCGCAGAGCTCCAGCGG - Exonic
1007705799 6:43790451-43790473 GGAGCACTGGGTAGCTCCAGAGG - Intergenic
1009413698 6:63394351-63394373 TGAGCAGTGAGGACCTCCAGAGG - Intergenic
1011579553 6:88844626-88844648 TGTGCACTGAATAACTCCAGAGG - Intronic
1011955906 6:93025291-93025313 TGTACACTGCAGAGCCACAGGGG - Intergenic
1012788132 6:103658138-103658160 TGTGCCCTGCAAAGCTACAGGGG - Intergenic
1013352980 6:109322661-109322683 TGTGCACTGTGAATCTCCAAAGG + Intergenic
1016070810 6:139736519-139736541 TGCACACTGCAGAGCTCGAGAGG - Intergenic
1017728820 6:157296356-157296378 TGTGCCCTGCACACCTCCAGGGG + Intronic
1018628958 6:165805685-165805707 AGTGAACTGGGGAGATCCAGAGG - Intronic
1018964606 6:168474683-168474705 TGTGCACTGCACAACTCCAGGGG + Intronic
1019734628 7:2644670-2644692 TGGGCACTGCAGAGCATCAGGGG - Intronic
1020271680 7:6600330-6600352 CGTGCACAGCAGAGCTCCTGAGG - Exonic
1020369715 7:7418511-7418533 TGTGCACTGGAGATCTCCAAGGG - Intronic
1023275719 7:38516778-38516800 TGTGCCCTGCAGAGCCACAGAGG + Intronic
1023909482 7:44543006-44543028 TGGGCACAGCTGGGCTCCAGGGG - Intergenic
1028314543 7:89384004-89384026 TGTGCACTGCAAAGCCACAGGGG + Intergenic
1028885321 7:95926039-95926061 TGTGCATTAAGCAGCTCCAGAGG + Intronic
1030440566 7:109583841-109583863 TGTTCACTGGGCAGCTCCAGTGG + Intergenic
1032466746 7:132150857-132150879 TGTGCACTGCACAGCTCTAAGGG - Intronic
1032742893 7:134757289-134757311 TGTGCACTGCACAACTCCAGGGG - Intronic
1035541851 8:446110-446132 TGTGCAGTGAAGTGCTCCAGAGG - Intronic
1036284810 8:7434796-7434818 TGTGCTCTGCAGAACTGCAGAGG - Intergenic
1036336664 8:7876734-7876756 TGTGCTCTGCAGAACTGCAGAGG + Intergenic
1036371390 8:8165720-8165742 TGTGCATTGCTTACCTCCAGGGG - Intergenic
1036879513 8:12499924-12499946 TGTGCATTGCTTACCTCCAGGGG + Intergenic
1038207605 8:25482085-25482107 TGTCTCCTGCTGAGCTCCAGGGG + Intronic
1038246486 8:25861127-25861149 TGTGCGCTGGGGAGCTAGAGAGG + Exonic
1038427669 8:27474675-27474697 TGTGAACAGAGCAGCTCCAGTGG - Intronic
1042367881 8:67957398-67957420 TGTGCTCCCTGGAGCTCCAGAGG + Intronic
1043975996 8:86585455-86585477 TGTACACTGCACAACTCCAGAGG - Intronic
1045362731 8:101448309-101448331 TGTGCACTGAGTAACTCCAGGGG - Intergenic
1048195650 8:132329876-132329898 TGTGCACTGAACAACTCCAGGGG - Intronic
1048523760 8:135182100-135182122 TGTGCACTGCACAACTGCAGTGG + Intergenic
1049256286 8:141615651-141615673 TGTGCACTGTGGAACTGCGGTGG + Intergenic
1049340250 8:142108607-142108629 TGTGGACTGAGGTCCTCCAGGGG - Intergenic
1050004779 9:1118771-1118793 TGTGCACTGCACAACTCCAAAGG + Intergenic
1050555278 9:6784449-6784471 TGTGAACTCCTGACCTCCAGTGG + Intronic
1051499359 9:17760058-17760080 TGTGTACTGCACAACTCCAGGGG + Intronic
1052048973 9:23824344-23824366 CGTCCGCCGCGGAGCTCCAGTGG + Intronic
1052492031 9:29181987-29182009 TGTGTACTATGCAGCTCCAGGGG - Intergenic
1053885383 9:42641630-42641652 TGTGCACTGCAAAGCCACAGAGG + Intergenic
1054224402 9:62449079-62449101 TGTGCACTGCAAAGCCACAGAGG + Intergenic
1055192460 9:73542032-73542054 TGTGCTCTACACAGCTCCAGGGG - Intergenic
1055223879 9:73970359-73970381 TGTGCCCTGCAGAGCCACAGGGG + Intergenic
1057983056 9:99681612-99681634 TGGGCCCTGCGGAGCCACAGTGG - Intergenic
1061149641 9:128821429-128821451 GGTGCACCGCGGACCTGCAGGGG - Exonic
1062245770 9:135565344-135565366 TGAGAGCTGGGGAGCTCCAGAGG - Intronic
1062530675 9:136998207-136998229 TGTGGACTGTGGAGCGGCAGTGG + Intergenic
1188213132 X:27446779-27446801 TGAGCACTGAGGACCACCAGAGG + Intergenic
1189011399 X:37049059-37049081 TGTGCCCTGCAGAGCCACAGGGG + Intergenic
1193417412 X:81241211-81241233 TGTGCACTGAGGAGCATGAGAGG + Intronic
1193671312 X:84389770-84389792 TGTGCACTGGGCAGCTCCGGTGG - Intronic
1196601935 X:117611487-117611509 TGTGCACTGCACAACTCCACAGG + Intergenic
1199016237 X:142819525-142819547 TGTGCACTGGGCAGCTCCAGTGG + Intergenic
1199565117 X:149207689-149207711 TGTGCACTGTACAGCTCTAGGGG - Intergenic