ID: 991236627

View in Genome Browser
Species Human (GRCh38)
Location 5:64406844-64406866
Sequence CCTGGGAAGCAGAAAGGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991236620_991236627 3 Left 991236620 5:64406818-64406840 CCGAAGCAGGGTGGGGTGTCACC 0: 32
1: 94
2: 215
3: 415
4: 833
Right 991236627 5:64406844-64406866 CCTGGGAAGCAGAAAGGGTCAGG No data
991236614_991236627 17 Left 991236614 5:64406804-64406826 CCACGGAGGGCAAGCCGAAGCAG 0: 18
1: 136
2: 489
3: 796
4: 1252
Right 991236627 5:64406844-64406866 CCTGGGAAGCAGAAAGGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991236627 Original CRISPR CCTGGGAAGCAGAAAGGGTC AGG Intergenic
No off target data available for this crispr