ID: 991243654

View in Genome Browser
Species Human (GRCh38)
Location 5:64486421-64486443
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991243654_991243656 11 Left 991243654 5:64486421-64486443 CCAGGAGTGTTGGCATTGTTCAC No data
Right 991243656 5:64486455-64486477 TCTGCTTCAGATTTTTCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991243654 Original CRISPR GTGAACAATGCCAACACTCC TGG (reversed) Intergenic
No off target data available for this crispr