ID: 991244992

View in Genome Browser
Species Human (GRCh38)
Location 5:64501197-64501219
Sequence GACCAAAGAACTTTAGCATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991244992_991244996 18 Left 991244992 5:64501197-64501219 CCCAATGCTAAAGTTCTTTGGTC No data
Right 991244996 5:64501238-64501260 CATTATTAAACCAGTCATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991244992 Original CRISPR GACCAAAGAACTTTAGCATT GGG (reversed) Intergenic
No off target data available for this crispr