ID: 991254149

View in Genome Browser
Species Human (GRCh38)
Location 5:64596311-64596333
Sequence CTGTCTGCCTTGAGAGATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 1, 2: 3, 3: 12, 4: 204}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991254144_991254149 7 Left 991254144 5:64596281-64596303 CCAGGATGTGGCTAACTCCGTTC 0: 1
1: 0
2: 0
3: 2
4: 39
Right 991254149 5:64596311-64596333 CTGTCTGCCTTGAGAGATCATGG 0: 1
1: 1
2: 3
3: 12
4: 204
991254143_991254149 13 Left 991254143 5:64596275-64596297 CCTGGTCCAGGATGTGGCTAACT 0: 1
1: 0
2: 0
3: 10
4: 89
Right 991254149 5:64596311-64596333 CTGTCTGCCTTGAGAGATCATGG 0: 1
1: 1
2: 3
3: 12
4: 204
991254146_991254149 -10 Left 991254146 5:64596298-64596320 CCGTTCTCCCTGGCTGTCTGCCT 0: 1
1: 0
2: 7
3: 133
4: 1288
Right 991254149 5:64596311-64596333 CTGTCTGCCTTGAGAGATCATGG 0: 1
1: 1
2: 3
3: 12
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991254149 Original CRISPR CTGTCTGCCTTGAGAGATCA TGG Intronic
900429340 1:2594502-2594524 CTCTCTGCCTTGATGGACCAGGG + Intronic
900540394 1:3199821-3199843 CTGTCTTCCCGGAGAGACCACGG + Intronic
903335583 1:22622127-22622149 CTGTCTGCCTGGAGAAAGCCAGG + Intergenic
905238750 1:36568359-36568381 CTATCTGCCTTGAGGGAGGAGGG - Intergenic
905419223 1:37828228-37828250 TTGTCTGCAGGGAGAGATCATGG + Intronic
906502673 1:46352932-46352954 CTATGTGCCTGAAGAGATCAGGG + Exonic
906638359 1:47425496-47425518 CTGTCTCCCTTGAGTTATGAAGG + Intergenic
908065598 1:60400678-60400700 CTGCCTTCCTTGGGAGAACAAGG + Intergenic
908151464 1:61306831-61306853 TTGTCTGTCTTGACATATCAGGG + Intronic
910439482 1:87238183-87238205 ATTTCTGCCTGGAGAGATCATGG + Intergenic
910889696 1:92005251-92005273 CTTTCTGCCTTGCTAAATCACGG - Exonic
919592037 1:199516311-199516333 CAGTCTGGCTTGATAAATCAAGG + Intergenic
920365240 1:205444826-205444848 CTCTCTGCCTTGGGAGATGAAGG - Intronic
922779554 1:228240715-228240737 ATGTCTGCCATGAGGGGTCAGGG + Intronic
922898530 1:229119004-229119026 CTGGCTGCCTTGTGAGCTCTGGG - Intergenic
923234889 1:232022628-232022650 CTGTCTGTCCAGAGAGAGCAGGG - Intronic
1064705770 10:18070752-18070774 CTGTCCTCCTTCAGAGATCCTGG - Intergenic
1065554174 10:26897741-26897763 CTGTCTGCCTCCAGAGATCATGG - Intergenic
1065599154 10:27350866-27350888 CTATCTGCCTCCAGGGATCATGG + Intergenic
1066182604 10:32977952-32977974 CTGTCTACAGTGAAAGATCAGGG - Intronic
1067126108 10:43516934-43516956 CTGTGTCCCTTTAGAGATGAAGG - Intergenic
1067319420 10:45204162-45204184 CTGTCTGCCTCCAGGGATTACGG + Intergenic
1067327071 10:45279614-45279636 CTGTCTGCCTGCAGAAACCATGG - Intergenic
1068326892 10:55502134-55502156 CTACCTGCCTTGAAACATCAGGG + Intronic
1069635177 10:69920609-69920631 CTCTCTGCCTTGTGAGAACACGG + Intronic
1070954977 10:80457772-80457794 GTGTCTGTCTGGACAGATCACGG + Intronic
1072329754 10:94336195-94336217 CTGTCTGCCATGTGAGGGCATGG + Intronic
1073222758 10:101889847-101889869 TTGTCTGACTTGGGAGAACAGGG + Intronic
1076560683 10:131361350-131361372 CTGTCTTCCCTGAAAGACCAAGG - Intergenic
1076774337 10:132686084-132686106 CAGGCTGCCTTCAGAGACCAGGG + Intronic
1077300066 11:1842662-1842684 CTGTCAGCCTTCAAAGAGCAGGG - Intergenic
1081712210 11:45224627-45224649 CTGTCGGCCTTGAATGATGAAGG - Exonic
1083016793 11:59462460-59462482 CTATCTGCCTTGACAAATCCTGG - Intergenic
1084195716 11:67522866-67522888 CTTTCTGCCTAAAGAGTTCACGG - Intronic
1084288359 11:68146280-68146302 CTGTGTGCCAAGAGAGGTCAGGG - Intergenic
1085311268 11:75518303-75518325 CTTCCTGCCTGGAGAGATGAGGG - Intronic
1085408191 11:76276580-76276602 CTGTCTGACTTCAGAGCCCACGG + Intergenic
1086086489 11:82960594-82960616 ATGTCTAGCTTGAGAGATGAGGG - Intronic
1086487707 11:87326268-87326290 CTTTCTGTCTTGAGAGATTCAGG + Intergenic
1086891014 11:92258397-92258419 GGGTCTGCCTTGAGGGATCGTGG + Intergenic
1087823450 11:102737505-102737527 CACTCTGCCTTGAGATTTCAGGG - Intergenic
1088081953 11:105928699-105928721 CATTCTGCCTTGAGTGATAAAGG + Intronic
1090236997 11:125156338-125156360 CTCTCTGCCTTGTGTGAGCAAGG - Intergenic
1099941468 12:89194256-89194278 CTGCCTACATTTAGAGATCAGGG - Intergenic
1100384585 12:94093666-94093688 ATGTTTGCCTAGAAAGATCAGGG - Intergenic
1102744208 12:115235526-115235548 CGTTCTGCCTTGAGAAATCTAGG - Intergenic
1103916029 12:124376161-124376183 GTGGCTGCTCTGAGAGATCAGGG - Intronic
1104210925 12:126687872-126687894 CTTTCTGGCCTGACAGATCAGGG - Intergenic
1104596250 12:130121811-130121833 CTGTCTGCCTGGAGACATTCTGG - Intergenic
1104776856 12:131394645-131394667 CTGTCTGCCTGGAGAGGGCCAGG - Intergenic
1105818113 13:24055411-24055433 CTGTCTGCCTAGGGAGATGGAGG + Intronic
1108546455 13:51500196-51500218 CCCTCTGCCTTGAGAGAGTAGGG - Intergenic
1113389980 13:109886189-109886211 CTGTCTGTCTTCAGTGTTCATGG - Intergenic
1113727658 13:112617202-112617224 CTGTCTGCCTTGGGAGCACTGGG + Intergenic
1114245205 14:20906362-20906384 CTGTCTGCCTTGAGGGCACCAGG + Intergenic
1114537697 14:23433337-23433359 CTGTCTTCCCTGTGAGATCCTGG - Intronic
1115528918 14:34308060-34308082 CTGATTGCTTTGAGAGGTCATGG - Intronic
1116034857 14:39615543-39615565 CTGTGTGCCCTGAGAGAGGATGG + Intergenic
1116813015 14:49557244-49557266 CTGTCTGACTTCAAAGTTCAAGG - Intergenic
1117008286 14:51444628-51444650 CTGTCTGCCTTGAATGGTGATGG + Intergenic
1117476413 14:56099692-56099714 CTTTCTTCCATGATAGATCAAGG - Intergenic
1120506962 14:85364851-85364873 CTGTCACCCTTGAGACAGCAAGG - Intergenic
1120614228 14:86682686-86682708 CTATCTGATTTGAGAGATTATGG + Intergenic
1120708053 14:87765006-87765028 TTGTCTGCCTTGTTAGATTAAGG - Intergenic
1121013369 14:90534572-90534594 CTGTCGGCCTTGAGAGGTGGTGG + Exonic
1121042289 14:90759029-90759051 CTGTCTGTCTTGAGAGACTGCGG + Intronic
1121397470 14:93638950-93638972 CTGTCTGCTTTTATAGATGACGG + Intronic
1121831725 14:97058173-97058195 TTGTCTGCTGGGAGAGATCAAGG + Intergenic
1123031870 14:105455817-105455839 CTGTCTGCCTGGAGAGATGTGGG - Intronic
1124991117 15:34674720-34674742 CTTTCTGCCTTGAGGGATGTGGG + Intergenic
1125569209 15:40702333-40702355 CTTTTTGCCTTGCGAGATCTTGG + Intronic
1128675376 15:69604555-69604577 CTGTCTGGCTTCAAAAATCAGGG - Intergenic
1129181829 15:73882534-73882556 CTGGCTCCCTTGGGAGATCTGGG - Intronic
1131366321 15:91845095-91845117 CTGTCATGCTGGAGAGATCAGGG + Intergenic
1132522961 16:399881-399903 CTGTGTGCCCTGGGAGAACACGG - Intronic
1132699610 16:1216710-1216732 CTGTCTACCTGGTGAGGTCATGG + Intronic
1135258687 16:20962738-20962760 CCTTCAGCCTTGAGAGGTCAAGG - Intronic
1136635337 16:31517924-31517946 CTGTCTGCCTCAAAGGATCATGG - Intergenic
1136665828 16:31811462-31811484 CTGTCTGCCTCAAAGGATCATGG - Intergenic
1139571345 16:67814627-67814649 CTCTCTGCCTAGGGAGATCCGGG - Intronic
1142012263 16:87721618-87721640 CTGTGTGACTTGGGAGATCCCGG - Intronic
1142024218 16:87803926-87803948 CTGTCTGCAATGAGAGCTCTAGG - Intergenic
1142540556 17:655447-655469 CTGTCTGCCTGGAGTGAATATGG + Intronic
1142540567 17:655517-655539 CTGTCTGCCTGGAGTGAATATGG + Intronic
1143270611 17:5672207-5672229 CTGGGTCCCTTGAGAGCTCATGG + Intergenic
1146690821 17:34874713-34874735 CTTCCTGCCTTGGAAGATCAGGG + Intergenic
1149162015 17:53705713-53705735 ATGTATGCTTTAAGAGATCATGG - Intergenic
1149200054 17:54175015-54175037 CTTTCTGCCTTCAGAGATTCAGG + Intergenic
1152224320 17:79085713-79085735 CTGTCGGCTTGGAGAGATCCAGG + Exonic
1155698774 18:28717006-28717028 CTGTGTGCATTGAGAAATTAAGG + Intergenic
1158405018 18:57153142-57153164 CTGCCTGCCTTGAGAGATCAAGG - Intergenic
1159334870 18:67048857-67048879 CTCTCAGTCTTGCGAGATCAGGG + Intergenic
1159590403 18:70328356-70328378 ATGTCCTCCTTGTGAGATCATGG + Exonic
1161307350 19:3575406-3575428 CTGTCTGCCTGGAGGGAATAGGG + Intronic
1162117692 19:8441372-8441394 CTGTCTGCTTTTAAAGCTCAGGG + Intronic
1162728922 19:12706079-12706101 CTGTCTGCCTGTCGAGGTCACGG + Intronic
1165610238 19:37145284-37145306 CTTTCTGCCATGCGAGAACACGG - Intronic
1167997457 19:53417977-53417999 CTCTCTGCCTCCAGGGATCAAGG + Intronic
925166593 2:1719418-1719440 CTGTGTGCCTTGAGGGTACATGG + Intronic
926152306 2:10432105-10432127 CTATCTGCCTCTTGAGATCAGGG + Intergenic
926791665 2:16578016-16578038 CTGTCTGCCTGGTGAGGCCAAGG + Intronic
927468251 2:23352608-23352630 CTATCTGTCTTCAGAGAGCAAGG + Intergenic
928550387 2:32364819-32364841 CTGCCTGCTCTGAGAGGTCATGG + Intronic
934129086 2:88929730-88929752 CTTTCTGCCTTAAGGGAGCAGGG + Intergenic
934685104 2:96315425-96315447 CTGTGGGACTTGAGAGAGCAAGG + Intergenic
935127041 2:100233488-100233510 CTGGCTGCCTTGACACAACAGGG - Intergenic
935306552 2:101742271-101742293 CAGTCTGCCTAAAGAAATCAAGG - Intronic
937264541 2:120607703-120607725 CACTCTGCCTTGAGATATCACGG + Intergenic
937452026 2:122009914-122009936 CTGCCTGGCTGGAGAGCTCAAGG + Intergenic
937468430 2:122155046-122155068 CTGTATGCTTTGTGAGATCAGGG - Intergenic
938173674 2:129104791-129104813 CTGTGTGCCATGAGGGTTCAGGG + Intergenic
938755503 2:134375623-134375645 ATGTCTGCCTTTAGAGAGCTTGG + Intronic
940396757 2:153198736-153198758 CTGTTTTTCTTGACAGATCAGGG + Intergenic
941360663 2:164547187-164547209 GTGTCTGTTTAGAGAGATCAAGG - Intronic
942771374 2:179524998-179525020 ATGTCTGCCTCGAGTGATGATGG - Intronic
944542308 2:200765862-200765884 GTGTGTGCCTGGAGAGGTCAGGG - Intergenic
948101588 2:235378556-235378578 CTGTGTGCCTTAAAAGATCTCGG + Intergenic
948393124 2:237626872-237626894 CTGTCTGCCCCCTGAGATCAAGG - Intergenic
949016947 2:241718943-241718965 CTGTCTGACTTTAGATATAAAGG + Intronic
1169066899 20:2698824-2698846 CTGGCTGCCTTGATAACTCAAGG - Intronic
1170044400 20:12070447-12070469 TTGTCTGCCTTGAAAGATTGAGG - Intergenic
1170957552 20:20995256-20995278 CTGTCTGCCTCGATAGCACAAGG + Intergenic
1171062415 20:21978659-21978681 CAGCATGCCTTGTGAGATCATGG - Intergenic
1173871915 20:46347706-46347728 TTTTCTGCCTTGAGGGCTCAAGG - Intronic
1174107604 20:48173848-48173870 CTGTCTGCCTTGGATAATCAGGG - Intergenic
1174614547 20:51825737-51825759 CTGACCTCCTTCAGAGATCATGG + Intergenic
1176111033 20:63410836-63410858 CTGTCTGCCCTGAGCTGTCAGGG + Intronic
1176266232 20:64210861-64210883 CCTTCTGCCTAGAGAGGTCAAGG - Intronic
1178086599 21:29118627-29118649 CTTTGTGCCTTCACAGATCAAGG - Intronic
1181426864 22:22849288-22849310 CTGTCTGGCTGGAGGGACCAGGG + Intronic
1183283437 22:36947003-36947025 CTGTCTTCTATGACAGATCATGG + Intergenic
1184247452 22:43242796-43242818 CTCTCCACCTGGAGAGATCATGG + Intronic
952870170 3:37892165-37892187 CTGTCTGACTTCAGAGTTAAAGG - Intronic
953442319 3:42928950-42928972 CTGAATGGCTTGAGAGAGCAGGG - Intronic
956441364 3:69283513-69283535 CTGTTTGTCTTGAGAAAGCAAGG - Intronic
959140826 3:102484552-102484574 CTGACCTCCTTGAGAGATAAAGG + Intergenic
960420080 3:117434676-117434698 CTGCCTTCCTTCACAGATCAGGG - Intergenic
961567362 3:127773259-127773281 CTGTCTGGCTCTAGAGTTCAAGG - Intronic
963855117 3:150245333-150245355 TTTTCTGCCTTGAGCTATCAGGG - Intergenic
965620594 3:170639039-170639061 ATGTCTGCCTAGAGAAATAAGGG + Intronic
965690297 3:171349153-171349175 CTGTTTTTCTTGAGAGATGAAGG - Intronic
967583640 3:191188107-191188129 CTGTCTTCCTTGAGTGACTATGG + Intergenic
968788113 4:2639554-2639576 CTGTGTGCCTTGAGACATACAGG + Intronic
971797384 4:31245028-31245050 TTGTCTGTTTAGAGAGATCACGG - Intergenic
975672762 4:76798326-76798348 CTGTAAGCCTTGAAAGAGCAGGG - Intergenic
980262091 4:130462810-130462832 CTCTCTGGCTTGAGAAATAATGG - Intergenic
983954139 4:173677225-173677247 GTGTCAGCATTAAGAGATCAGGG + Intergenic
985490426 5:175609-175631 GTGTCTGCCTGGAGGGGTCAGGG - Intronic
985490510 5:175903-175925 GTGTCTGCCTGGAGGGGTCAGGG - Intronic
985490526 5:175961-175983 GTGTCTGCCTGGAGGGGTCAGGG - Intronic
987526223 5:19053407-19053429 GGGTCTGCCTTAAGAGAACAAGG - Intergenic
988063570 5:26204955-26204977 CTTTCTTTTTTGAGAGATCATGG + Intergenic
988644421 5:33078584-33078606 CTGTCTGGTTTTAAAGATCATGG - Intergenic
990742828 5:58929756-58929778 ATATCTGCCTTGAAAGATCAGGG - Intergenic
991254149 5:64596311-64596333 CTGTCTGCCTTGAGAGATCATGG + Intronic
991392729 5:66165738-66165760 ATGTATGTCTTGAGAGAGCAGGG + Intronic
992441485 5:76801274-76801296 CTGTGTGGCTGGAGAGAGCATGG + Intergenic
992917316 5:81470818-81470840 CTGTGTTTCTTGAGAGATAATGG - Intronic
995998668 5:118332153-118332175 ATGCCAGGCTTGAGAGATCAGGG - Intergenic
999587325 5:153104575-153104597 CTGTCTGTCTGTAGAGAACAAGG + Intergenic
999650541 5:153763152-153763174 CTGTCTGCCTAGAGTGAAAAGGG + Intronic
1002077710 5:176718825-176718847 CTTTCTTCCTTGACAGAGCAGGG - Intergenic
1006593545 6:35176153-35176175 CTTCCTCCCTAGAGAGATCATGG + Intergenic
1007404895 6:41629493-41629515 CTGTCTCCCTTGAGGGACAAGGG + Intergenic
1007932264 6:45702314-45702336 CTGTCCGCCTTGAGTGATCAGGG + Intergenic
1007984214 6:46191132-46191154 CTGTTGGCCTTGAGGGAACAAGG + Intergenic
1008197819 6:48546732-48546754 CTATCTGCCTTGAGCCATTATGG - Intergenic
1009559210 6:65217975-65217997 TTGTCTCCATTGAGAGATCTTGG + Intronic
1009779027 6:68244979-68245001 CTGTCTCCCTTCGGAGCTCATGG + Intergenic
1010991001 6:82479916-82479938 CTCTCTGCAGTGAGAGAGCAGGG + Intergenic
1011700604 6:89951107-89951129 CCGCCTGCCTGGAGAGATCCAGG - Exonic
1013010052 6:106112141-106112163 CTGTTTCCTTTCAGAGATCATGG + Intergenic
1018392923 6:163354157-163354179 CTTTCTGCCTGAAGAGCTCAGGG + Intergenic
1018629116 6:165806716-165806738 CTGGTTCCCTTGAGAGATTAGGG - Intronic
1019431185 7:1000606-1000628 CTGTCTGCCCTGAGAGATCGGGG + Intronic
1020435810 7:8161246-8161268 CTGTCCTCCTTAAGAGATGAGGG - Intronic
1021854412 7:24839631-24839653 CTTTTTGCCCTGAGATATCAGGG - Intronic
1023481300 7:40637422-40637444 CTTTCTTCCTTTAGAGATCCTGG - Intronic
1024179709 7:46879312-46879334 TTGTATTCCTTGACAGATCAGGG - Intergenic
1024233921 7:47383863-47383885 CTGTCCACCTAGACAGATCAGGG + Intronic
1027046957 7:74997320-74997342 CTGTCTGCCTTCAGGAACCAGGG - Intronic
1027354055 7:77339445-77339467 CTGCCTTCCTTGATGGATCATGG + Intronic
1029251882 7:99242837-99242859 CTCTCTGCCTTGAGAGTTAGCGG - Intergenic
1029386038 7:100244311-100244333 CTGTCTGCCTTCAGGAACCAGGG + Intronic
1031877465 7:127158248-127158270 CTGTCAGCCTAGAGAGGACATGG + Intronic
1032488361 7:132305458-132305480 CTGGCTGCCTTGGAAGATCCCGG - Intronic
1033967192 7:146990393-146990415 ATATCTGCCTTGTAAGATCATGG + Intronic
1034231986 7:149537376-149537398 CTCTGAGCCTTGAGAGATAAAGG + Intergenic
1034609641 7:152354192-152354214 CTGTCTCCTATGAGAGGTCAAGG - Intronic
1034693861 7:153036821-153036843 CTGTCATCCATGAGAGGTCAAGG - Intergenic
1036504966 8:9347007-9347029 CTGTCTGACTGGAGAGCTGAGGG - Intergenic
1042286648 8:67120129-67120151 CTTTCTGCATTGAGAGATATTGG + Intronic
1042984294 8:74566206-74566228 CTGTCTCCCTTGGGAGACCAAGG - Intergenic
1043516873 8:81002930-81002952 CTTTCTGCCTGGAGAGGGCAGGG + Intronic
1043649307 8:82568760-82568782 GTGTCTGCATTGAGAAATCTGGG - Intergenic
1045595537 8:103650683-103650705 ATAGCTGCCTTGACAGATCATGG - Intronic
1046477399 8:114764082-114764104 CTGAGTACCTTGAGAGGTCAAGG - Intergenic
1046508458 8:115167087-115167109 CTGACAGGTTTGAGAGATCAAGG + Intergenic
1049052090 8:140206475-140206497 CTGTCTTCCTTGGCAGAACAAGG + Intronic
1049664377 8:143836526-143836548 CTGGCTGCCAGCAGAGATCATGG - Intronic
1051404391 9:16719669-16719691 CTGTATGCCTTGTGAGACAATGG + Intronic
1052484290 9:29076126-29076148 CTCTGTGCTTTGGGAGATCAAGG - Intergenic
1053241567 9:36499791-36499813 CTGTCTGCATTAAGAGATAGGGG + Intergenic
1055571334 9:77620123-77620145 CTATCTGCCTTGAATGATCAAGG + Intronic
1057126481 9:92619790-92619812 CTGCTTGCCGTGAGAGGTCAGGG - Exonic
1057956677 9:99414763-99414785 CTGGCAGCCTTGAGAAATGAGGG - Intergenic
1058011797 9:99986392-99986414 TTGTCTGCCTTCTGAGATCTTGG + Intronic
1058216931 9:102246079-102246101 CTACCTGCCTAGAGAGCTCAGGG + Intergenic
1059494294 9:114696883-114696905 CTCTCTGCAGAGAGAGATCAGGG + Intergenic
1060218289 9:121751441-121751463 CTGTCTGTCTGGAGAGACCAGGG + Intronic
1060429786 9:123540908-123540930 CTGTCTGCCTCTAGAACTCACGG - Intronic
1061589824 9:131591177-131591199 ACGTCTGTCTTGATAGATCAGGG + Intronic
1062304642 9:135897612-135897634 CTATCTGCTTGGAGAGATCCTGG + Intronic
1062405300 9:136393349-136393371 CCCTCTGCCTTGAGAGCTCATGG + Intronic
1186944759 X:14553496-14553518 CTTTCTGCCTTGATAGATGATGG + Intronic
1187638577 X:21261529-21261551 CTGTCTGGCTTCAGAGTTAAAGG - Intergenic
1188385195 X:29548898-29548920 CTGTTTGCCTTGATTCATCAAGG + Intronic
1189353866 X:40297064-40297086 CTGTCTGCCTGGAATGATGATGG + Intergenic
1192004795 X:67198964-67198986 CTCTCTGCCTTGAAAGCTTAGGG - Intergenic
1193580112 X:83253381-83253403 CTGTGTGCTTTCAGAGATGAAGG - Intergenic
1196645453 X:118112844-118112866 CTTTATTCCTTGAGAGATTAGGG - Intronic