ID: 991256689

View in Genome Browser
Species Human (GRCh38)
Location 5:64622052-64622074
Sequence CCTCATCTTCTGTAGCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991256689_991256693 2 Left 991256689 5:64622052-64622074 CCCTCCAGCTACAGAAGATGAGG No data
Right 991256693 5:64622077-64622099 CTCTTTATGTTCTTCCCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991256689 Original CRISPR CCTCATCTTCTGTAGCTGGA GGG (reversed) Intergenic
No off target data available for this crispr