ID: 991256693

View in Genome Browser
Species Human (GRCh38)
Location 5:64622077-64622099
Sequence CTCTTTATGTTCTTCCCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991256692_991256693 -2 Left 991256692 5:64622056-64622078 CCAGCTACAGAAGATGAGGTTCT No data
Right 991256693 5:64622077-64622099 CTCTTTATGTTCTTCCCAAAAGG No data
991256689_991256693 2 Left 991256689 5:64622052-64622074 CCCTCCAGCTACAGAAGATGAGG No data
Right 991256693 5:64622077-64622099 CTCTTTATGTTCTTCCCAAAAGG No data
991256691_991256693 1 Left 991256691 5:64622053-64622075 CCTCCAGCTACAGAAGATGAGGT No data
Right 991256693 5:64622077-64622099 CTCTTTATGTTCTTCCCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991256693 Original CRISPR CTCTTTATGTTCTTCCCAAA AGG Intergenic
No off target data available for this crispr