ID: 991257762

View in Genome Browser
Species Human (GRCh38)
Location 5:64634019-64634041
Sequence GGTCCCTGTACCTACCATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991257762_991257766 2 Left 991257762 5:64634019-64634041 CCATCATGGTAGGTACAGGGACC No data
Right 991257766 5:64634044-64634066 TGCAATGGGATCTTGCAGTGTGG No data
991257762_991257767 3 Left 991257762 5:64634019-64634041 CCATCATGGTAGGTACAGGGACC No data
Right 991257767 5:64634045-64634067 GCAATGGGATCTTGCAGTGTGGG No data
991257762_991257768 14 Left 991257762 5:64634019-64634041 CCATCATGGTAGGTACAGGGACC No data
Right 991257768 5:64634056-64634078 TTGCAGTGTGGGAGAGAGACTGG No data
991257762_991257769 15 Left 991257762 5:64634019-64634041 CCATCATGGTAGGTACAGGGACC No data
Right 991257769 5:64634057-64634079 TGCAGTGTGGGAGAGAGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991257762 Original CRISPR GGTCCCTGTACCTACCATGA TGG (reversed) Intergenic
No off target data available for this crispr