ID: 991257765

View in Genome Browser
Species Human (GRCh38)
Location 5:64634040-64634062
Sequence ACTGCAAGATCCCATTGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 504
Summary {0: 2, 1: 26, 2: 62, 3: 124, 4: 290}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991257765_991257771 17 Left 991257765 5:64634040-64634062 CCACTGCAATGGGATCTTGCAGT 0: 2
1: 26
2: 62
3: 124
4: 290
Right 991257771 5:64634080-64634102 CTCAACTCTGAAAACACCATGGG No data
991257765_991257772 24 Left 991257765 5:64634040-64634062 CCACTGCAATGGGATCTTGCAGT 0: 2
1: 26
2: 62
3: 124
4: 290
Right 991257772 5:64634087-64634109 CTGAAAACACCATGGGCAAGTGG No data
991257765_991257768 -7 Left 991257765 5:64634040-64634062 CCACTGCAATGGGATCTTGCAGT 0: 2
1: 26
2: 62
3: 124
4: 290
Right 991257768 5:64634056-64634078 TTGCAGTGTGGGAGAGAGACTGG No data
991257765_991257773 25 Left 991257765 5:64634040-64634062 CCACTGCAATGGGATCTTGCAGT 0: 2
1: 26
2: 62
3: 124
4: 290
Right 991257773 5:64634088-64634110 TGAAAACACCATGGGCAAGTGGG No data
991257765_991257769 -6 Left 991257765 5:64634040-64634062 CCACTGCAATGGGATCTTGCAGT 0: 2
1: 26
2: 62
3: 124
4: 290
Right 991257769 5:64634057-64634079 TGCAGTGTGGGAGAGAGACTGGG No data
991257765_991257770 16 Left 991257765 5:64634040-64634062 CCACTGCAATGGGATCTTGCAGT 0: 2
1: 26
2: 62
3: 124
4: 290
Right 991257770 5:64634079-64634101 GCTCAACTCTGAAAACACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991257765 Original CRISPR ACTGCAAGATCCCATTGCAG TGG (reversed) Intergenic
900812529 1:4817951-4817973 ACCACAAGACCCCTTTGCAGTGG - Intergenic
900846602 1:5108361-5108383 ACTGCAAAACCCCATTGCAGTGG - Intergenic
900878051 1:5360038-5360060 ACTGCAAAATTTCATTGAAGTGG - Intergenic
901440057 1:9272332-9272354 CCTCCCAGATCCCATTGCTGCGG - Intergenic
902147478 1:14415644-14415666 TCTGCATGATCCCAGTCCAGAGG - Intergenic
902190968 1:14762818-14762840 AGTGCAAGTTCCCAGTGCTGAGG - Intronic
902312640 1:15593396-15593418 ACTACAAGATTCCATTGCAGTGG - Intergenic
902670465 1:17969751-17969773 GCTGCAAAGTCCCATTGCAATGG + Intergenic
903517966 1:23925150-23925172 ACTGCAAAACCCCATTGAAGTGG + Intergenic
903957730 1:27036690-27036712 AAAGCAAGATCCCTTTGGAGAGG + Intergenic
904268510 1:29332408-29332430 ACTGTAAGGTCCCTCTGCAGCGG + Intergenic
904413492 1:30340304-30340326 ACTGCAAAATCCCACTGCAATGG - Intergenic
904819962 1:33235595-33235617 ACTACAAAATCCTATTGCAGTGG - Intergenic
907372690 1:54013552-54013574 ACTGCAAGAGGCCAGTGCACAGG - Intronic
907650067 1:56286484-56286506 ACTGCAACCTCCCATTGCAGTGG - Intergenic
907720248 1:56965177-56965199 ACTTCAACATCTCATGGCAGGGG + Intronic
908029929 1:59988230-59988252 ACTGCAAAACTCCATTGCAGTGG + Intronic
909034235 1:70579135-70579157 ACTGCAAAACCTCATTGGAGTGG + Intergenic
909318503 1:74253414-74253436 CATGCAAGAGCCCATGGCAGGGG + Intronic
910310875 1:85823059-85823081 ATTGCAAAATCCCATTGCAGTGG + Intronic
910365885 1:86465199-86465221 ACTGCAAGACCTCCTTGCAATGG - Intergenic
910712291 1:90194241-90194263 ACTGGAAAATCCCATTATAGGGG - Intergenic
910719692 1:90272450-90272472 CCTGCAAGACCCTATTGCAGTGG + Intergenic
910892548 1:92032775-92032797 GCTGCAACATCACATGGCAGAGG + Intronic
911400705 1:97371372-97371394 AATGCAAGATCACATAGCAATGG + Intronic
911429610 1:97767337-97767359 GCTGCAAAGTCCCATTGCAAAGG - Intronic
912486584 1:110033981-110034003 ACTGCAAGATCTGGTTGTAGTGG + Intronic
912848804 1:113103501-113103523 GCTGCAACATCACATTGCCGTGG + Intronic
914049676 1:144120996-144121018 ACTTAAAGATCCCAGTCCAGTGG + Intergenic
914129506 1:144844455-144844477 ACTTAAAGATCCCAGTCCAGTGG - Intergenic
914266980 1:146046436-146046458 ACTGCAAGATTCTGTTGCAGTGG - Intergenic
915141915 1:153773242-153773264 ACTGTCAGAGCCCACTGCAGAGG - Exonic
915547201 1:156607047-156607069 ACTGCAAAATCCCATTGTCATGG + Intergenic
916142456 1:161711398-161711420 TCTGGAAGATGCCACTGCAGTGG - Exonic
916217554 1:162410354-162410376 GCCGCAAGAGCTCATTGCAGTGG + Intronic
916842747 1:168616390-168616412 ACTGTAAGACCCTGTTGCAGTGG + Intergenic
916951765 1:169787605-169787627 ACTGCAAAATCCCATTGCCATGG + Intronic
918732074 1:188011783-188011805 ACTACAAACTCCCATTGCAGTGG - Intergenic
919561354 1:199123969-199123991 ACTGCAATAGCACATTGCAAAGG + Intergenic
920055936 1:203191681-203191703 ACTGCAAGACCCCATTGCCCTGG + Intergenic
920189141 1:204181272-204181294 ACTGCAAGAACCTGTTGCAGTGG - Intergenic
921883559 1:220280448-220280470 ACTACTAGATGCCATAGCAGGGG + Intergenic
922162046 1:223085188-223085210 ACTGCAAGACCCCACTGCAGTGG - Intergenic
922232622 1:223699991-223700013 CCCGCAAAACCCCATTGCAGTGG + Intergenic
922369551 1:224895752-224895774 GCTGCAAAATTCCATTGCAGTGG - Intergenic
923649846 1:235864194-235864216 ACTGCAGGGCCCCACTGCAGAGG + Intronic
924505823 1:244682938-244682960 ACTGCAAAATCCCATTGCCATGG - Intronic
924549260 1:245059437-245059459 GCTGCATGATCTGATTGCAGAGG + Exonic
1063096942 10:2916394-2916416 ACTGTAAGTTCCCATTTCAGAGG - Intergenic
1065266628 10:23983229-23983251 ACTGCAAAGTCTCATAGCAGAGG + Intronic
1065346804 10:24756283-24756305 ACTGCAAAATCACATTGCAAAGG - Intergenic
1069156018 10:65032049-65032071 ACTACAAGATGACATTTCAGTGG + Intergenic
1069473536 10:68713765-68713787 ACTGTAAAATCCCACTGTAGTGG - Intergenic
1070027413 10:72645390-72645412 ACTGTGAGACTCCATTGCAGTGG - Intergenic
1070286387 10:75086908-75086930 ACTGCAAAATCCCACTGTTGTGG + Intergenic
1071223080 10:83492671-83492693 ACTGCAAAATATCATTGAAGTGG - Intergenic
1071725716 10:88196457-88196479 ACTGCAATATCACATGGCAAAGG - Intergenic
1074047448 10:109851593-109851615 GCTGCAAGACACCATTGCAGGGG + Intergenic
1074751253 10:116589515-116589537 GCTGCAAGATCACATTGCAAAGG + Intergenic
1074839923 10:117340573-117340595 ACTTCAAGACCTCACTGCAGTGG + Intronic
1074848022 10:117415953-117415975 ACTGCAAGACCCTGTTACAGTGG - Intergenic
1075121627 10:119668853-119668875 ACTGCACGACCCCACTGCCGTGG - Intronic
1075502770 10:122992203-122992225 ACTGCAAGAACTCATTACAGTGG + Exonic
1075624640 10:123953341-123953363 ACTCTGAGACCCCATTGCAGTGG - Intergenic
1076244270 10:128933928-128933950 ACTGCAAAATCCCATTGCCTTGG + Intergenic
1077233172 11:1467795-1467817 ACAGCAAGAACCCATCCCAGTGG + Intergenic
1078739213 11:14050974-14050996 CGTGCATCATCCCATTGCAGTGG + Intronic
1078795248 11:14585849-14585871 ACTGCAAGACTTCATTGCAGTGG + Intronic
1078934364 11:15938763-15938785 GCTGGAAGAACCCATGGCAGTGG - Intergenic
1080766024 11:35297410-35297432 ACTCCAAAATCCCGTTGCTGTGG + Intronic
1082081527 11:48016007-48016029 ACTGCAAGGTTCCTTTGCAGTGG + Intronic
1082939525 11:58689471-58689493 ATGGCAAAGTCCCATTGCAGTGG - Intronic
1083543770 11:63534116-63534138 GCTGCAAAATCCCAGTGCAGTGG - Intergenic
1084042223 11:66548811-66548833 AATGTAAGCTCCCATGGCAGGGG - Intronic
1084972587 11:72780059-72780081 ATTGCCAGAGCCCATTGCAAGGG + Intronic
1086836536 11:91631255-91631277 TCTGCAAGACCCAATTGCAGTGG - Intergenic
1087083298 11:94192942-94192964 ACTGTGAAATCCCATTGCAGTGG - Intergenic
1087899510 11:103625126-103625148 ACTGCAAGACCCTGTTGCAGTGG - Intergenic
1087932370 11:103992834-103992856 ACTGCAAGAGCCTATTACACTGG - Intronic
1088354942 11:108933072-108933094 ACTAAAAAACCCCATTGCAGTGG - Intronic
1088681551 11:112247688-112247710 ACTGCAAGACCCTGTTGCAGTGG + Intronic
1090026081 11:123168655-123168677 GCTGCTGGATCCGATTGCAGAGG - Intronic
1090096179 11:123743649-123743671 ACAGCAAGACTTCATTGCAGTGG - Intergenic
1090286808 11:125506648-125506670 ACTGCAGAATCCTATTGCAGTGG + Intergenic
1090305322 11:125686398-125686420 ACTGCAAGAGCGCACTGCATTGG + Intergenic
1091885887 12:4016810-4016832 ACTGCAAAATTCCATTGCCATGG - Intergenic
1092000710 12:5029811-5029833 ACAGCCAGACCCCTTTGCAGTGG - Intergenic
1092345352 12:7710047-7710069 ACAAAAAAATCCCATTGCAGGGG - Intergenic
1092789067 12:12056188-12056210 ACCACAAGACCCTATTGCAGTGG + Intronic
1093019191 12:14187437-14187459 ACTGCAAGACCCCATTGCCCTGG - Intergenic
1093073920 12:14737160-14737182 ACTGCAAGACCCCACTGCAATGG - Intergenic
1094122224 12:26986493-26986515 ACTGCAAAATTCCATCACAGTGG + Intronic
1094125122 12:27015225-27015247 ACTGCAAGACCCAGTTGCAGTGG - Intergenic
1094364539 12:29666030-29666052 ACTGCAAAATTCCATCACAGTGG + Intronic
1094375932 12:29787218-29787240 ACTGAAGGACCGCATTGCAGTGG + Intergenic
1095309996 12:40687432-40687454 GCTGCATCATCCCATGGCAGAGG - Intergenic
1095443220 12:42259101-42259123 ACTGCAAGACCTCATTGTGGTGG - Intronic
1097503965 12:60440618-60440640 ACTGTAAGACCTCATTGCAGAGG + Intergenic
1098572633 12:72006295-72006317 ACTGCAAAACCCCATTGCAGTGG - Intronic
1098907973 12:76180951-76180973 ACTACAAGACCCCATTTCTGTGG - Intergenic
1100498199 12:95145646-95145668 ACTGCAAAATCCCATTGCAGTGG + Intronic
1100751411 12:97702251-97702273 ACTGCAAGATCCCATCACAGTGG + Intergenic
1100950427 12:99842723-99842745 ACTGCAAAATCCCATTGCAGTGG + Intronic
1100989213 12:100234232-100234254 ACTGCAAAATCCCATAGCAGTGG - Intronic
1101056947 12:100927270-100927292 TCTGCAAGTTCCCATTCCACCGG - Intronic
1101695521 12:107122150-107122172 ATTGCAAAATTCCATTGCAGTGG + Intergenic
1102711963 12:114936075-114936097 TCTGCAACATCACTTTGCAGGGG - Intergenic
1103208842 12:119151946-119151968 GCTGCAAAGTCACATTGCAGGGG + Intronic
1103212653 12:119178302-119178324 ACTGCAAAATCCCATTGCAGGGG + Intergenic
1105486809 13:20841280-20841302 ACTGCAAGATCCTGTTGTGGTGG + Intronic
1106093969 13:26626107-26626129 ACTGCAAGATGCTGTTGCAGTGG - Intronic
1106948249 13:34853225-34853247 ACTGCAAAATCCAATTGCAGTGG - Intergenic
1108291481 13:48966202-48966224 GCTACAAGGCCCCATTGCAGTGG - Intergenic
1109089074 13:58016110-58016132 ATTGCAAAACCCCATTGCAGTGG + Intergenic
1109263457 13:60170042-60170064 CCTGCAAAACCCCATTGCACTGG - Intergenic
1109627552 13:64995397-64995419 ACTGCAAAATCCCATTGCAGAGG - Intergenic
1109761748 13:66839507-66839529 ACTGCAAGTACCCATCGCACAGG - Intronic
1109935780 13:69282592-69282614 ACTGCGAGATCCCATTGCAGTGG - Intergenic
1110318814 13:74136698-74136720 ACTACAAGAATCCATTCCAGAGG + Intergenic
1110893233 13:80716127-80716149 ACTGCAAGACCCTATTGCAGTGG - Intergenic
1111213288 13:85108786-85108808 ACTGCAGCTTCCCATTGCATGGG + Intergenic
1111339958 13:86871236-86871258 ACTGCAAAATCCCATTGCTGTGG + Intergenic
1111742132 13:92217617-92217639 AGTGCAAAATCCCAGAGCAGTGG + Intronic
1112027600 13:95426051-95426073 ACTGCAAAATCCCATTGCAGTGG - Intergenic
1112063939 13:95771373-95771395 AGTACAAGACCCCACTGCAGTGG - Intronic
1112278656 13:98043972-98043994 ACAGCAAAATCCCATTGCTGTGG - Intergenic
1112904578 13:104401065-104401087 ACTGCAGGATCCCACTGCAGGGG + Intergenic
1113022902 13:105908586-105908608 ACTGCATGATCGTATTGGAGTGG + Intergenic
1114377560 14:22164624-22164646 ACTGCAAAATCCTGTTGCAGTGG - Intergenic
1114676828 14:24446793-24446815 ACTGCAAGACCACATTGTAGTGG + Intergenic
1115022670 14:28701777-28701799 ACTGCAAGACCTGGTTGCAGTGG - Intergenic
1115646126 14:35369519-35369541 CCTGCAAGATCCCAGCTCAGTGG + Intergenic
1115827008 14:37289762-37289784 ACTGCCAGGTCCCTCTGCAGAGG + Intronic
1116618085 14:47163776-47163798 ACTGGAAGGACCCATTCCAGTGG + Intronic
1117087317 14:52214856-52214878 ACTGCAAAATCCCATTGCTGTGG + Intergenic
1117333838 14:54739704-54739726 GCTGCAAGATGCCATTGCTGAGG + Intronic
1118037980 14:61889114-61889136 ACTGCAAGACCCTATGGCAGTGG - Intergenic
1118368092 14:65112827-65112849 TCTGCAAGACCCGGTTGCAGTGG - Intergenic
1118523205 14:66610707-66610729 ACTGTAAAATCCCATGTCAGTGG - Intronic
1119934939 14:78583453-78583475 ATTGCCAGTTCCCATTGAAGTGG + Intronic
1121037183 14:90716072-90716094 ACTGCAAGACCCAGTTGCAGTGG - Intronic
1121138235 14:91518007-91518029 ACTGTGAGACCCCATTGCAATGG - Intergenic
1121568291 14:94926958-94926980 AGTCCAAGATCCCATAGCTGGGG - Intergenic
1121702862 14:95969051-95969073 ACTTCAAAGTCTCATTGCAGGGG - Intergenic
1121997374 14:98613759-98613781 GCTGCAAGGTCACATTGCACAGG + Intergenic
1122588405 14:102827031-102827053 CGTGCAAGGTCCCCTTGCAGAGG + Intronic
1123154203 14:106208798-106208820 ACTGCAAAATCCCACTGCCCTGG - Intergenic
1123419546 15:20120218-20120240 ACTTAAAGATCCCAGTCCAGTGG + Intergenic
1123446318 15:20333294-20333316 ACTTAAAGATCCCAGTCCAGTGG - Intergenic
1123901970 15:24886406-24886428 ACTGCAAGGCCCCATTACGGCGG + Intronic
1123905297 15:24914828-24914850 ATTGCAAAATCCCATTGCATTGG - Intronic
1124018235 15:25896848-25896870 ATTGCAAGCCTCCATTGCAGTGG + Intergenic
1124552567 15:30695137-30695159 ACAGCAAGATCTCAGGGCAGGGG - Intronic
1124620117 15:31269029-31269051 TCTGGAAGTTCGCATTGCAGAGG + Intergenic
1124668524 15:31616111-31616133 TGTGCAAGACCCCATTGCTGGGG - Intronic
1125410412 15:39400316-39400338 ACTGCAAGACCCCACTGTGGTGG - Intergenic
1126493625 15:49266350-49266372 ACTGCAAAGTCACATTGCAAGGG + Intronic
1127506630 15:59604213-59604235 ACTGGGTGATTCCATTGCAGAGG - Intronic
1128136577 15:65268086-65268108 CCTGCAAAACCACATTGCAGAGG - Intronic
1128480362 15:68032316-68032338 ACTGCAAAACCCTGTTGCAGTGG + Intergenic
1128963707 15:72036408-72036430 ATTGCAAGAACCCTTGGCAGAGG + Intronic
1129070180 15:72944484-72944506 ATTGCAAAATCTTATTGCAGTGG + Intergenic
1129147224 15:73659509-73659531 ACTGCAAGACCTCATTGCGGTGG + Intergenic
1129449162 15:75640334-75640356 AACGCGAGATCCCAGTGCAGAGG - Intronic
1129979075 15:79849835-79849857 AATGCAAGATCACATTGGAAAGG - Intronic
1131162443 15:90116335-90116357 ACTACAAGACCCCATCACAGTGG - Intergenic
1131483126 15:92798943-92798965 ACTGCAAGACCCTGTGGCAGTGG - Intronic
1132137076 15:99351800-99351822 ACTACAAGACCCAGTTGCAGTGG - Intronic
1133936035 16:10270138-10270160 ACTGCAAAACCCCATTGCAGTGG + Intergenic
1135054632 16:19220666-19220688 ACTGAAAAATCCCATTACTGTGG - Intronic
1135077032 16:19402578-19402600 CCTGCAAGATCACATTGAAAAGG + Intergenic
1136056040 16:27690467-27690489 GCTGCAAAACCACATTGCAGCGG + Intronic
1136085036 16:27878802-27878824 ACTGCAAGCCCCCAAGGCAGTGG - Intronic
1140755478 16:78062772-78062794 ATTGCAAAACCCCATTGCTGTGG - Intronic
1140997466 16:80275101-80275123 ACAGCAAGATCCCATCCTAGAGG + Intergenic
1141509473 16:84503491-84503513 ACTACAAAATCCCATTGCTGTGG + Intronic
1142123879 16:88400680-88400702 AGTGCAAGGCCCCATTCCAGAGG + Intergenic
1143890240 17:10097245-10097267 ACCGCAAGCTCCTATGGCAGTGG + Intronic
1144051645 17:11502089-11502111 ACTGCCATATACCATTGCAGAGG + Intronic
1144077572 17:11733107-11733129 ACTTCAATCTGCCATTGCAGTGG + Intronic
1144344879 17:14340487-14340509 ACTGCAAGACTCCACTGCAGTGG + Intronic
1144457541 17:15431417-15431439 AGCGCATGATCGCATTGCAGTGG - Intergenic
1144566586 17:16364434-16364456 ATAGCAAAATCCCATTACAGTGG - Intergenic
1144587113 17:16493509-16493531 ACTGCAAAATCTCATAGCAGAGG - Intergenic
1144588254 17:16502057-16502079 ACTGCAAGACCCTGTTGCAGTGG + Intergenic
1146387926 17:32394077-32394099 ATAGCAAGATCCCATGTCAGAGG + Intergenic
1149011807 17:51864596-51864618 ACTGTAAAATCCCATTGAAAAGG - Intronic
1149254236 17:54806811-54806833 ACCACAAGACCCCATTGCTGGGG + Intergenic
1149702652 17:58668274-58668296 ACTACAAGACCCCATTGCAGCGG + Intronic
1152219711 17:79056541-79056563 ACCACAAGACCCCATTGCAATGG - Intergenic
1152301910 17:79499900-79499922 ACTGCAAAATCGCATGGCAAAGG - Intronic
1153134911 18:1905721-1905743 ACTGCAAAATCCCATTGCAGTGG - Intergenic
1153354644 18:4121716-4121738 ACTGCAAGACCCTGTTGCAGTGG + Intronic
1153693791 18:7619894-7619916 ACTGCAAGTTTCCATGGCACAGG - Intronic
1153944019 18:10003124-10003146 ACTGCAAAATCCCACAGCTGTGG + Intergenic
1156455735 18:37292767-37292789 ATTGCAAAATCACCTTGCAGCGG - Intronic
1156774632 18:40772050-40772072 TCTGCAAAATCCTATTGCAGTGG + Intergenic
1158383776 18:56966100-56966122 ACTGCAAGACCCCGTTGTAGCGG - Intronic
1159507494 18:69356083-69356105 ACTAAAAGATCCCATTGCAGTGG + Intergenic
1162250621 19:9440114-9440136 ACTGCAAAATCCTACTGCAGTGG - Intergenic
1162878369 19:13638035-13638057 AATGCAAGATGGCACTGCAGAGG + Intergenic
1163614147 19:18316866-18316888 ACTGCCAGGCCCCAATGCAGGGG + Intronic
1164960864 19:32428390-32428412 ACTGCAAGACCTCATTGCAGTGG - Intronic
1166766392 19:45254050-45254072 GCTGCAACCTCCCATTCCAGAGG - Intronic
1167401285 19:49272188-49272210 ACTGTAGAATCACATTGCAGAGG - Intergenic
1202689066 1_KI270712v1_random:73559-73581 ACTTAAAGATCCCAGTCCAGCGG + Intergenic
925351228 2:3202011-3202033 ACTGCAAGCTCCAATTCCCGGGG + Intronic
925689246 2:6504454-6504476 CCTGCAAAGTCACATTGCAGCGG + Intergenic
925748739 2:7068102-7068124 GTTGCAAAATCCCTTTGCAGTGG + Intronic
926582694 2:14648739-14648761 TAGGCAAGATCTCATTGCAGTGG - Intronic
927064821 2:19460728-19460750 AACCCAAGACCCCATTGCAGTGG + Intergenic
927258960 2:21067481-21067503 ACTTCTAGATCCCATTGAAGTGG + Intergenic
927498870 2:23568709-23568731 ACTGCAACACCACATTGCAAAGG + Intronic
927562881 2:24085752-24085774 ACTGCAAGAACTCATTGCAGTGG + Intronic
928012234 2:27620521-27620543 ACTGCAAGACTCCACTGCAGTGG - Intronic
928581577 2:32713101-32713123 GCTGCATCATCCCATGGCAGAGG - Intronic
928606750 2:32950228-32950250 TCAGCAATATCCCATTGCAGTGG - Intronic
928824987 2:35409676-35409698 ACTGCAAGACCCTGTTTCAGTGG - Intergenic
929347249 2:40899785-40899807 ACTGCAAGACCCCCTCACAGTGG + Intergenic
930121647 2:47765697-47765719 ACTTCAGCAGCCCATTGCAGTGG - Intronic
930176289 2:48304605-48304627 ACTGTAAAATCTCATTGCAGTGG + Intergenic
930362604 2:50400957-50400979 AATGCAAAATCCCAGAGCAGAGG + Intronic
930916907 2:56703268-56703290 ACTGCAAAATCGCATGGCAATGG - Intergenic
931058853 2:58503832-58503854 ACTGCAAGACCCCATTACAGTGG - Intergenic
932380504 2:71277427-71277449 ACTGCAAGATCCCGCTGCAGTGG + Intronic
932986842 2:76736466-76736488 ACTGCAAAATCCCATTGTCTTGG + Intergenic
933124329 2:78585540-78585562 GCTGCAAGACCCCACTGTAGTGG - Intergenic
933219541 2:79672196-79672218 ACTTCAAGAACCCAACGCAGGGG - Intronic
933293295 2:80461469-80461491 ACTGCAAATTCCCATTGCTAGGG + Intronic
933383374 2:81579926-81579948 AATGCAAGACTCCATTGCATAGG + Intergenic
933902246 2:86858458-86858480 ACTGCAAGGTCCCACAGCTGTGG - Intronic
933957372 2:87382542-87382564 ACTTAAAGATCCCAGTCCAGTGG - Intergenic
934103670 2:88676872-88676894 ACTGCAAGACCCATTTGCAGTGG + Intergenic
934241489 2:90274438-90274460 ACTTAAAGATCCCAGTCCAGTGG - Intergenic
934271685 2:91542246-91542268 ACTTAAAGATCCCAGTCCAGTGG + Intergenic
934602020 2:95664841-95664863 TCGGAAAGATCCCAATGCAGCGG + Intergenic
935130727 2:100259035-100259057 ACTGCTAGATGCCAGAGCAGGGG + Intergenic
935390119 2:102542358-102542380 ACTGCAAAATCTCATTACAGTGG - Intergenic
936428109 2:112436356-112436378 ACTGCAAAATCCCACTGCCCTGG + Intergenic
936535376 2:113306994-113307016 TCGGAAAGATCCCAATGCAGCGG + Intergenic
936773001 2:115937727-115937749 ATTGCAGGATCCCACTGCAGTGG - Intergenic
937540251 2:122941448-122941470 ACTGCAAGACCCCATTGCATTGG - Intergenic
937816859 2:126260252-126260274 ATTGCAAGATCCCATTGCAGTGG - Intergenic
938119227 2:128622193-128622215 GCTGCAAGCTCCCATTGCCATGG + Intergenic
938675691 2:133631745-133631767 AATGGAAGACCCCAATGCAGGGG - Intergenic
939101185 2:137896821-137896843 ACTGCAAATTCCTATTTCAGGGG + Intergenic
940898050 2:159099879-159099901 ACTGCAAAATCCTACTGCATTGG + Intronic
942597669 2:177607796-177607818 ACCGCAAAATCGCATTGCAGTGG - Intergenic
942675109 2:178418226-178418248 ACTGCAGAATCCCATTGTAACGG + Intergenic
942918466 2:181342084-181342106 ACTGCAAAATCGCATAGCAAAGG - Intergenic
943012278 2:182464291-182464313 ACTGCAAGACCCTGTTGCAGTGG - Intronic
943218078 2:185065210-185065232 ACTGCAAGACCCCATTGCGGAGG - Intergenic
944456764 2:199902985-199903007 ACTGCAAAGTCACATTGCATAGG - Intergenic
945253282 2:207782624-207782646 ACTGCAAAGTCCCATGGCAGAGG - Intergenic
945253838 2:207787624-207787646 ACTGCAAGACCCCACTGTGGTGG - Intergenic
945356004 2:208840675-208840697 GCTGCAAAATCCCATTGCAGTGG - Intronic
945673176 2:212826468-212826490 ACTCCAAAATCCCATTGTAAAGG - Intergenic
946537609 2:220648360-220648382 ACAGCAAGATCCAAGGGCAGAGG - Intergenic
947558178 2:231117737-231117759 ACTGCAAGATCTCTTTTCTGTGG - Intronic
947808030 2:232981997-232982019 AGTGGCAGAGCCCATTGCAGGGG + Intronic
947949223 2:234133567-234133589 TCTGCAAAACCCCATTGCCGTGG - Intergenic
948751912 2:240137908-240137930 ACTGCAAGATCCCGTTGCAGTGG + Intergenic
1169978206 20:11354170-11354192 GCTACAAAATCACATTGCAGAGG - Intergenic
1170085486 20:12526733-12526755 ACTGCAAAACCCAATTGCAGTGG + Intergenic
1171452390 20:25245431-25245453 GCTGCAAGATCCCGTTGCAGTGG - Intergenic
1172284164 20:33729469-33729491 ACTGCAAGGCCCCTTTGTAGTGG + Intergenic
1172573527 20:35988654-35988676 GCTGCAAGACTCCATTGCAGTGG - Intronic
1173059033 20:39644323-39644345 ACTGTAAGACCCCATTGCAATGG - Intergenic
1173484418 20:43429929-43429951 GCTGCAGGACCCCATTCCAGTGG - Intergenic
1175132314 20:56798585-56798607 ACTGCAAAGTCACATTGCAAAGG - Intergenic
1175561977 20:59938883-59938905 GCTGCAAGGTCCCCTGGCAGTGG - Exonic
1176374146 21:6078855-6078877 ACTGCAAAATCCCACTGCCCTGG - Intergenic
1176669372 21:9718080-9718102 ACTGTAAAACCCCATGGCAGTGG - Intergenic
1177292872 21:19138227-19138249 ACCGCAAAATCCCATTGCAATGG - Intergenic
1177415525 21:20788295-20788317 ACTGCAAGATTCTGTTGCAGTGG - Intergenic
1178810402 21:35876533-35876555 ACTCTGAGATCCCATTGCGGAGG + Intronic
1179595840 21:42442702-42442724 GCTGCAAAACCCCACTGCAGTGG - Intronic
1179749331 21:43459390-43459412 ACTGCAAAATCCCACTGCCCTGG + Intergenic
1180154214 21:45970408-45970430 CCTGCCAGAGCCCACTGCAGTGG - Intergenic
1181115999 22:20632856-20632878 GCTGCAGGATCCCAGGGCAGGGG + Intergenic
1181293286 22:21814813-21814835 ACTGCAAGACTCCATCTCAGGGG + Intronic
1181351671 22:22262979-22263001 ACTTAAAGATCCCAGTCCAGTGG + Intergenic
1181436827 22:22915968-22915990 GCTGCAGGATCCCAGGGCAGAGG + Intergenic
1181904871 22:26186403-26186425 ACTGCAAAATCCCATTGCAGTGG - Intronic
1182137755 22:27921532-27921554 ACTACAAAATCCCATTACAGTGG - Intergenic
1182219043 22:28743122-28743144 ACTGCAAGACCCTATTGCAGTGG - Intronic
1183218857 22:36498854-36498876 ACTGTAAGACCCCTCTGCAGTGG + Intronic
1183682857 22:39344100-39344122 ATTGCAAGACTTCATTGCAGTGG - Intergenic
1184908512 22:47509258-47509280 ACTGCAAAATCCCATTTCAGTGG - Intergenic
949362782 3:3249364-3249386 ACTGCAAGTTCCTATTTCAGGGG + Intergenic
949703996 3:6794321-6794343 ACTGCAATGTTACATTGCAGAGG + Intronic
950616615 3:14165151-14165173 ACTGCAGGCTCACATAGCAGGGG - Intronic
951292386 3:20889103-20889125 ACTGCAAAATCTCATTGCTGTGG - Intergenic
951461721 3:22958231-22958253 ACTGCAAGACCCCATTGCAGTGG + Intergenic
952720394 3:36526271-36526293 ACTGCAAAGTCCCATGACAGGGG - Intronic
953937091 3:47054967-47054989 ACTCCAAGATCCCATCACAGTGG + Intronic
954412807 3:50378372-50378394 ACTGCAGGATCCATGTGCAGAGG + Intronic
954793947 3:53151984-53152006 TCTGCAAGATCTGCTTGCAGGGG - Intergenic
955090958 3:55749943-55749965 GATTCAAGATCCCATTGAAGAGG + Intronic
956362851 3:68467538-68467560 AGTCCAAGACCCCCTTGCAGTGG - Intronic
956988914 3:74739473-74739495 ACTGCAAGAGCCTGTTGCAGTGG + Intergenic
958055461 3:88405177-88405199 AATGCAAAATCTCATTGCAGTGG + Intergenic
958520222 3:95175746-95175768 ACTGCAAGACCCCATTGCAGTGG + Intergenic
958924351 3:100141509-100141531 ACTGTATGATCCCATTGCCAGGG + Intronic
959154368 3:102648707-102648729 AGTGCAAAATTCCATTGCTGTGG + Intergenic
959653787 3:108778247-108778269 AATGGAAGAACACATTGCAGAGG + Intergenic
959842481 3:110994271-110994293 ACTGCAAGACCCAGTTGCAGTGG - Intergenic
960154932 3:114290259-114290281 ACTGCAAAATCCCATTGCCTTGG + Intronic
960610574 3:119551529-119551551 GCTGCATCATCCCATGGCAGAGG - Intronic
961866162 3:129954899-129954921 ACTGCAAGCTCCCCTTGCCTGGG - Intergenic
962108027 3:132414083-132414105 ACTGCAAGCCCCTGTTGCAGTGG + Intergenic
963060492 3:141221117-141221139 ACTGCAAAACCCCATTGCAGTGG + Intergenic
963590240 3:147248085-147248107 ACAGCAAGAAGCCATTGCATAGG - Intergenic
963774346 3:149423063-149423085 CCTGCAAGACCCCATTGTAGAGG - Intergenic
964275169 3:155001640-155001662 ACTGCAAGCCCTCATTGCAGTGG + Intergenic
964310198 3:155384427-155384449 ATTGCAATATCCCATTGCAGTGG - Intronic
964979518 3:162662242-162662264 ACTGCAAAATCCCATTAGAGTGG - Intergenic
965463156 3:168993788-168993810 ATTGCAAGACTCCCTTGCAGTGG + Intergenic
965549158 3:169946701-169946723 ACTGCAGGGACCCCTTGCAGAGG - Intergenic
965681901 3:171260302-171260324 GCTGCAAGATGCTATTGCAATGG + Intronic
965770490 3:172176833-172176855 ACTGCAAGACCCTATTGCAGTGG - Intronic
967604533 3:191429995-191430017 AATGCAAGACCCAATTTCAGTGG - Intergenic
969480898 4:7446330-7446352 ACTGCGAGGTGCCATGGCAGGGG - Intronic
970855569 4:20646885-20646907 ACTGCAAGACCCCATTGCAGTGG + Intergenic
971983111 4:33780632-33780654 AATGCAAACTACCATTGCAGTGG + Intergenic
972047834 4:34691551-34691573 AGTGCAAAATCATATTGCAGTGG - Intergenic
972347328 4:38203528-38203550 ACTGCAAAGTCCCATGGCAAAGG + Intergenic
973647999 4:52969234-52969256 ACTGCAAGACCCTATTGTGGTGG + Intronic
975058518 4:69966975-69966997 ATTGCAAGTTACAATTGCAGAGG + Intergenic
975446369 4:74470053-74470075 AATGCAAGATGCCACTGCAGGGG + Intergenic
976158318 4:82171938-82171960 ACTGCAAAACCCCATTGCAGTGG - Intergenic
976287124 4:83381493-83381515 ACTGAAAAATCCCATCACAGTGG + Intergenic
976333016 4:83853286-83853308 ACTGCAAAATCCCATTGCCACGG + Intergenic
977165008 4:93683947-93683969 ACTGCAAAATCCCATTGCAGTGG - Intronic
977993627 4:103476096-103476118 ACTGCAAAATCCCATTTCAGTGG - Intergenic
978885912 4:113766250-113766272 ACTGCAAAACCCCCTTGCAGTGG - Intergenic
981120091 4:141039742-141039764 ACTGCAAGCTCCTATTTCAGGGG + Intronic
983034219 4:162842540-162842562 ACTGCAAAATCTCATTGCAGTGG + Intergenic
983677130 4:170308826-170308848 ACTGCAATGCCTCATTGCAGTGG + Intergenic
984767354 4:183409816-183409838 ACGTCAAGGTCCCAGTGCAGAGG - Intergenic
984903961 4:184609909-184609931 ACTGCAAGCTCTTATTTCAGGGG - Intergenic
985405400 4:189633388-189633410 ACTGTAAAACCCCATGGCAGTGG + Intergenic
985566109 5:618541-618563 ACTGCAAAATCCCAGCGCAGTGG - Intronic
985879749 5:2629200-2629222 TCTGCAAGATCCCCTTGCTATGG - Intergenic
986134296 5:4959790-4959812 ACTGCAAGACCCTGTTGCAGTGG - Intergenic
987148168 5:15012764-15012786 ACTGCAAAATCCCATTGCCATGG - Intergenic
988131814 5:27116289-27116311 ACTGCAAAATCCCATTGCAGTGG - Intronic
988581196 5:32470410-32470432 ACTGCATGATTCCACTGCAGTGG - Intergenic
989134693 5:38142158-38142180 CCTGAAATAGCCCATTGCAGTGG + Intergenic
990276415 5:54201714-54201736 ACTGCAAGAACCCAATGCAGTGG + Intronic
991139771 5:63226710-63226732 AATGCAAAACCCCATTGCAGTGG - Intergenic
991257765 5:64634040-64634062 ACTGCAAGATCCCATTGCAGTGG - Intergenic
993398261 5:87417317-87417339 ACTGCAAGACCTTACTGCAGTGG + Intergenic
993399394 5:87430187-87430209 ACTGCAAGACCCCATTGTAGTGG - Intergenic
993672834 5:90783104-90783126 ATTCCAAGTTCCCATTACAGTGG + Exonic
993953323 5:94201777-94201799 ACTGCAAGACCCCATTGAAGTGG - Intronic
994173712 5:96686857-96686879 ACTGCAAAATTCCCTTGCAGTGG - Intronic
994570142 5:101505258-101505280 AGTGCAAGATTCCATAGCACTGG + Intergenic
994865837 5:105268426-105268448 ACTGCAAAATCTCATTGCAGTGG + Intergenic
995356485 5:111243142-111243164 ACTGCAGGACCCCATTGCAGTGG - Intronic
995898716 5:117044788-117044810 ACGGCAAAATCCCATTGCAGTGG + Intergenic
996416228 5:123213629-123213651 ACGGCAAGATCTCATTGCTTTGG + Intergenic
998455755 5:142271696-142271718 ACTGCAAGACCCCATTGCAGTGG - Intergenic
998456207 5:142275486-142275508 ACTGCAAGACCCCATTGCAATGG + Intergenic
1000490522 5:161906946-161906968 ACTGCAAGACCCCATGGCAGTGG + Intergenic
1002130218 5:177076671-177076693 TCTGCAAGATCCCATTGCAGTGG + Intronic
1002449738 5:179311831-179311853 ACTGCAAGAGCCCACTCTAGCGG + Intronic
1003762207 6:9192265-9192287 ACTGCAAATCCCCATTCCAGAGG + Intergenic
1004144884 6:13056622-13056644 ACTGCAAGACCCTATTGCAGTGG - Intronic
1004280212 6:14274175-14274197 ACCGCAAGACCCCATTGCTGTGG - Intergenic
1004814672 6:19300139-19300161 GCTGCAACATCCCAATGCACAGG - Intergenic
1007044604 6:38759924-38759946 GCTACAAGATCCCATTGCAGTGG + Intronic
1007417735 6:41701990-41702012 ACTGCAAGAGCACAGTGAAGTGG + Intronic
1008157243 6:48031405-48031427 GCTGCAAGACCCCACTGCAGTGG + Intronic
1010004772 6:70983775-70983797 ACTGCAAGACCCCATTGCAGTGG - Intergenic
1010720786 6:79281267-79281289 ACTGCAAGAGCCTGTTGCAGTGG - Intergenic
1011212647 6:84970569-84970591 ACAGCAAGGTCACATTGCAGAGG + Intergenic
1011417131 6:87133584-87133606 ATTGCAAAATCCCAGTGCCGTGG + Intergenic
1011779605 6:90772079-90772101 ACTGCAAGACCCTGTTGCAGTGG + Intergenic
1012406632 6:98907996-98908018 ACTGCAAAATCCCATTGTAGTGG + Intronic
1012497061 6:99844955-99844977 GCTACAAGAACCCATTGCAGTGG + Intergenic
1012917090 6:105181756-105181778 ACTGCAAGCTCCTATTTCAGAGG - Intergenic
1013321528 6:108995423-108995445 GCTGCCAGATCCATTTGCAGAGG - Intronic
1013744564 6:113330053-113330075 ACTGCAAAATCCCATTGCAGTGG + Intergenic
1013962042 6:115912179-115912201 ACTGCAAGACCCCTTTGCAGTGG - Intergenic
1014524314 6:122482907-122482929 ACAGCAAGCTCCTATTTCAGCGG - Intronic
1014552984 6:122810389-122810411 ACTGCAGGATTCCATTGCAGTGG - Intergenic
1014576875 6:123083958-123083980 GCTGCAAGCTCCCATTGATGGGG - Intergenic
1014936201 6:127387814-127387836 ACTGCAAAATCACATTGCAGTGG + Intergenic
1015043087 6:128745003-128745025 GCTGCAGAATCCCATTGCAGGGG - Intergenic
1015231300 6:130917657-130917679 ACTGCAAAACCCCACTGCAAAGG + Intronic
1015871408 6:137779950-137779972 ACTGCAAGGGCCCAGTACAGTGG + Intergenic
1015996453 6:138999639-138999661 ACTGCAAAATCTGATTGCAGTGG + Intergenic
1016028827 6:139316553-139316575 ACTACAAGACCCTGTTGCAGTGG + Intergenic
1016372681 6:143391317-143391339 TCTGCAAGCCCCCATAGCAGGGG - Intergenic
1016393995 6:143603310-143603332 ACTGCAAAATCCCATGGCAGTGG - Intronic
1017144018 6:151217538-151217560 ACTGCAAGGCCCCATTGCAGTGG + Intergenic
1017926331 6:158914418-158914440 GCTGCAAAATCCCATTGCGGTGG + Intergenic
1018554060 6:165032760-165032782 ACTGAAAGCCCCCACTGCAGTGG + Intergenic
1021028165 7:15695302-15695324 TCTCCAAGATCCCACAGCAGGGG + Intergenic
1021273720 7:18623921-18623943 AGAGCAAGACTCCATTGCAGGGG + Intronic
1022539879 7:31125645-31125667 ACAGCAAAATCCCATTACACAGG + Intergenic
1025006862 7:55362381-55362403 ACTGCAAAATCCCATCGTGGTGG - Intergenic
1025963402 7:66245242-66245264 ACTGCAAGACCCGACTGCAGTGG - Intronic
1026288772 7:68987134-68987156 ACTGCAAGTCCCTGTTGCAGTGG + Intergenic
1026862430 7:73799568-73799590 ACTGCAAGACCCTGGTGCAGTGG + Intronic
1027671545 7:81105600-81105622 ACTGCGAAATTCCATTGCAGTGG - Intergenic
1027826605 7:83124275-83124297 ACTGCAAGCTCAGAGTGCAGTGG - Intronic
1027958305 7:84911046-84911068 ACTGCAAAACCCCATTGCTGTGG - Intergenic
1028580765 7:92407775-92407797 TCTGCATGCTCACATTGCAGAGG + Intergenic
1028808463 7:95056582-95056604 ACTGCAAAATCATATGGCAGGGG - Intronic
1028994068 7:97079952-97079974 ACTGCAAACTCCCAGTGCAGTGG + Intergenic
1029354873 7:100044298-100044320 ACTGCAAGACCCCACTGCAGTGG + Intergenic
1029633300 7:101767045-101767067 ACTGCAAGATCCCATCGTGGTGG + Intergenic
1029982115 7:104888562-104888584 ACTTCAAGATCTCTTTGCTGTGG - Intronic
1030075805 7:105735474-105735496 GCTGCAAGATCTCATCGCAAAGG - Intronic
1030392904 7:108949180-108949202 AATGAAAGATACCATTGCACGGG + Intergenic
1030845210 7:114400853-114400875 ACTGCAAGACCCCATTGCAGTGG - Intronic
1031049748 7:116932870-116932892 ACCGCAAAACCCCATTGCAGTGG + Intergenic
1031357121 7:120800673-120800695 ACTGCAAGACCACACTGCAGTGG + Intronic
1031929038 7:127665653-127665675 AATGCAAGACTCCACTGCAGTGG - Intronic
1032265571 7:130367884-130367906 ACTGCAAGATGACATTGGCGGGG - Exonic
1032635039 7:133697625-133697647 ACTGCGAGGCCCCATCGCAGTGG - Intronic
1032783512 7:135183118-135183140 CATGCAAGACTCCATTGCAGTGG + Intergenic
1033990998 7:147287074-147287096 ACTGCAAAATCCCATTGCTGTGG - Intronic
1034517408 7:151591536-151591558 ACTTGAAGCTCCCATTGGAGGGG - Intronic
1035555272 8:562970-562992 ACTGCAAAATTCCATTTCAGTGG - Intergenic
1035655054 8:1299158-1299180 AATGCAAGATGGCATTTCAGGGG + Intergenic
1036151638 8:6304742-6304764 ACTGCAAAATCCTATTGCAGTGG - Intergenic
1036569178 8:9964778-9964800 CCTGCGGGATCTCATTGCAGCGG + Intergenic
1036731736 8:11271589-11271611 ACTGCAACATGCAACTGCAGAGG - Intergenic
1036959066 8:13224309-13224331 TCTGGAAGATCCTATTGCTGAGG + Intronic
1037622616 8:20578109-20578131 ACTATAAGACCCCATTGCAGTGG - Intergenic
1037651598 8:20844045-20844067 ACTACAAGACCCCATTACAGTGG - Intergenic
1038301244 8:26351297-26351319 AATGCAAGACCCTGTTGCAGTGG + Intronic
1039733958 8:40309849-40309871 ATTGCAAGACCTCCTTGCAGAGG + Intergenic
1039811650 8:41054407-41054429 ACTGCAAGACCACATTGTAGTGG + Intergenic
1039849153 8:41347425-41347447 ACTGCAAGACCTCACTGCAGTGG - Intergenic
1040659605 8:49555601-49555623 ACTGAAATATCCCATGGGAGAGG + Intergenic
1041652747 8:60317132-60317154 ACTGCAATACCCCATCGCTGTGG + Intergenic
1043631290 8:82337801-82337823 ACTGCAAGACTTCATTGCAGTGG + Intergenic
1044805989 8:96008837-96008859 ACTACAAGATCACACTGCACAGG - Intergenic
1047757286 8:127928404-127928426 ACTGCAAATTCCCATTGCCGTGG + Intergenic
1047798557 8:128284532-128284554 AATGCAGGGTCCTATTGCAGAGG + Intergenic
1048546070 8:135388464-135388486 ACTGCAAGATTCCACTGCGGTGG - Intergenic
1048567268 8:135614850-135614872 ACTGCAAAGTCCCAGTGCAGTGG - Intronic
1049567849 8:143351211-143351233 ACTGCAAAACCCCATTACAGCGG + Intronic
1050658297 9:7853900-7853922 ATTGCAAGACCTCATTGCAGTGG - Intronic
1051464351 9:17360287-17360309 ACTGCAAAATCCGACTGCAGTGG - Intronic
1052551230 9:29951668-29951690 CCTGCAAGATACCATGACAGAGG - Intergenic
1052726558 9:32234929-32234951 ACTGCAAGACCCCATTACAATGG + Intergenic
1053185331 9:36011649-36011671 ACTGCAAAATCCCATGGCAGTGG - Intergenic
1054885432 9:70192757-70192779 ACTGCAAAATCCCGTTGCAGTGG - Intronic
1055663770 9:78532958-78532980 ACTGCAAGACTCCATTGCAGTGG - Intergenic
1056214498 9:84394488-84394510 ACTGCAAGACCTCATTGCAGTGG + Intergenic
1056676284 9:88679429-88679451 ACTGCAAGACCCCATTGCAGTGG - Intergenic
1058072061 9:100611248-100611270 CCTGCAAAGTCCCATTGCAAGGG + Intergenic
1058537555 9:105977826-105977848 ACTGCAAGACCCTGTTCCAGTGG - Intergenic
1058880344 9:109280323-109280345 ACTGGAAGAGCCAATTTCAGAGG - Intronic
1060979444 9:127784295-127784317 CCTGCAAGAAGCCATTGGAGTGG - Intergenic
1061659685 9:132120747-132120769 ACTGGATGCTCCCAGTGCAGAGG - Intergenic
1062314953 9:135962350-135962372 ACTGCAAGCCCCCTTGGCAGTGG + Intergenic
1203656495 Un_KI270753v1:2856-2878 ACTGTAAAACCCCATGGCAGTGG + Intergenic
1186207643 X:7216972-7216994 ACTGCAAGTCCCCATTGCTGTGG - Intergenic
1186221526 X:7354339-7354361 ACTACAAGTCCCCATTGCTGTGG + Exonic
1186834303 X:13422091-13422113 GCTTCTAGATCCCATTTCAGTGG - Intergenic
1186858853 X:13651793-13651815 ACTGCAAGACCCTGTTGCAGTGG + Intergenic
1187548994 X:20282387-20282409 ACTGCAAAGTCACATTGCAAAGG - Intergenic
1187695438 X:21914332-21914354 TCTGTAAGCTCCCTTTGCAGTGG - Intergenic
1188243132 X:27812261-27812283 AATGCAAGAGCCCATTACAAAGG + Intronic
1189078488 X:37943369-37943391 ATTTCAAGACCTCATTGCAGTGG - Intronic
1189650233 X:43181003-43181025 AATGCAAAACCCCATTACAGTGG + Intergenic
1190110139 X:47583948-47583970 ACTGCAAGATCCCATTGCAGTGG - Intronic
1190175604 X:48146536-48146558 ACCGCAAGACCCCATTGCGGTGG + Intergenic
1190182891 X:48208428-48208450 ACTGCAAGACCCCATTGCAGTGG + Intronic
1190186369 X:48238080-48238102 ACTGCAAGACCCCATTGCGGTGG + Intronic
1190195609 X:48315672-48315694 ACCACAAAAACCCATTGCAGTGG - Intergenic
1190195766 X:48317030-48317052 ACTGCAAGACCCCATTGCGGTGG + Intergenic
1190201716 X:48367486-48367508 ACTGCAAGACCCCATTGCAGTGG - Intergenic
1190208823 X:48427925-48427947 ACTGCAAGACCCCATTGCAGTGG + Intergenic
1190307734 X:49095116-49095138 AATGCATGCTCCCTTTGCAGAGG - Intronic
1190368492 X:49719602-49719624 ACTGCAAAACTCCATTGTAGTGG + Intergenic
1190379690 X:49828090-49828112 ACTGCAAGATCCCATTGCAATGG - Intergenic
1190433259 X:50398294-50398316 ACTGGAAGGTCCCATCCCAGAGG - Intronic
1190662059 X:52663884-52663906 ACCACAAAAACCCATTGCAGTGG - Intronic
1190662466 X:52667393-52667415 ACCGCAAGACCCCATTGCAGTGG + Intronic
1190668554 X:52718023-52718045 ACCGCAAGACCCCATTACGGTGG - Intergenic
1190670863 X:52740381-52740403 ACCGCAAGACCCCATTACGGTGG + Intergenic
1190761905 X:53443965-53443987 ACTGCAAGACCCCATTGCAGTGG - Intergenic
1190952830 X:55162732-55162754 ACTGCAAAACCCCATAGCAGTGG + Intronic
1192339506 X:70251645-70251667 ATTGCTAGATCCCTTTCCAGAGG - Intergenic
1192614197 X:72601319-72601341 ACTGCAAGACCTCATTGCAATGG - Intronic
1192811719 X:74553079-74553101 ACTGCAAGACCCCGTTGCAGTGG - Intergenic
1193553369 X:82926146-82926168 ACTTCAAAATCCTGTTGCAGTGG + Intergenic
1194280611 X:91948680-91948702 ACCGAAAGTTCCCATTGCAGTGG - Intronic
1194600102 X:95910021-95910043 ACCGCAAGACCCCATTCAAGTGG + Intergenic
1194800263 X:98264271-98264293 AGTGCAAGCTCCCATTACAAGGG + Intergenic
1195652323 X:107298281-107298303 ACTGCAAAATCCCATTTTCGTGG - Intergenic
1196078194 X:111600667-111600689 CCTGCAAAATCCCATTTCAGTGG + Intergenic
1197214084 X:123851888-123851910 ACTGCAAAATCTCATTGCAGTGG - Intergenic
1198835922 X:140804932-140804954 TCTGCAATATCATATTGCAGGGG - Intergenic
1199936582 X:152580223-152580245 ACTGCAAGACTCCATTGCAGTGG + Intergenic
1200598087 Y:5172176-5172198 ACCGCAAGTTCCCATTGCAGTGG - Intronic
1201579469 Y:15495643-15495665 ACTGCAAGTCCCCATTGCTGTGG - Intergenic