ID: 991257767

View in Genome Browser
Species Human (GRCh38)
Location 5:64634045-64634067
Sequence GCAATGGGATCTTGCAGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991257762_991257767 3 Left 991257762 5:64634019-64634041 CCATCATGGTAGGTACAGGGACC No data
Right 991257767 5:64634045-64634067 GCAATGGGATCTTGCAGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991257767 Original CRISPR GCAATGGGATCTTGCAGTGT GGG Intergenic
No off target data available for this crispr