ID: 991257769

View in Genome Browser
Species Human (GRCh38)
Location 5:64634057-64634079
Sequence TGCAGTGTGGGAGAGAGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991257762_991257769 15 Left 991257762 5:64634019-64634041 CCATCATGGTAGGTACAGGGACC No data
Right 991257769 5:64634057-64634079 TGCAGTGTGGGAGAGAGACTGGG No data
991257765_991257769 -6 Left 991257765 5:64634040-64634062 CCACTGCAATGGGATCTTGCAGT 0: 2
1: 26
2: 62
3: 124
4: 290
Right 991257769 5:64634057-64634079 TGCAGTGTGGGAGAGAGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991257769 Original CRISPR TGCAGTGTGGGAGAGAGACT GGG Intergenic
No off target data available for this crispr