ID: 991261533

View in Genome Browser
Species Human (GRCh38)
Location 5:64673814-64673836
Sequence CATTAAATGGATAAATTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991261533_991261536 -1 Left 991261533 5:64673814-64673836 CCATACAATTTATCCATTTAATG No data
Right 991261536 5:64673836-64673858 GTCTACATTTCAATGGTTTCTGG No data
991261533_991261535 -8 Left 991261533 5:64673814-64673836 CCATACAATTTATCCATTTAATG No data
Right 991261535 5:64673829-64673851 ATTTAATGTCTACATTTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991261533 Original CRISPR CATTAAATGGATAAATTGTA TGG (reversed) Intergenic
No off target data available for this crispr