ID: 991263239

View in Genome Browser
Species Human (GRCh38)
Location 5:64689155-64689177
Sequence GACTGCGGCTTTAACCAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991263239_991263245 23 Left 991263239 5:64689155-64689177 CCTAACTGGTTAAAGCCGCAGTC No data
Right 991263245 5:64689201-64689223 ATGGTAAAAGGCTCCTTTGTTGG No data
991263239_991263244 11 Left 991263239 5:64689155-64689177 CCTAACTGGTTAAAGCCGCAGTC No data
Right 991263244 5:64689189-64689211 CTTAAGCTTCATATGGTAAAAGG No data
991263239_991263241 4 Left 991263239 5:64689155-64689177 CCTAACTGGTTAAAGCCGCAGTC No data
Right 991263241 5:64689182-64689204 CACTGCCCTTAAGCTTCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991263239 Original CRISPR GACTGCGGCTTTAACCAGTT AGG (reversed) Intergenic
No off target data available for this crispr