ID: 991263240

View in Genome Browser
Species Human (GRCh38)
Location 5:64689170-64689192
Sequence TAAGGGCAGTGTTAAGACTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991263240_991263247 23 Left 991263240 5:64689170-64689192 CCGCAGTCTTAACACTGCCCTTA No data
Right 991263247 5:64689216-64689238 TTTGTTGGTTTGAACTTCAGAGG No data
991263240_991263244 -4 Left 991263240 5:64689170-64689192 CCGCAGTCTTAACACTGCCCTTA No data
Right 991263244 5:64689189-64689211 CTTAAGCTTCATATGGTAAAAGG No data
991263240_991263245 8 Left 991263240 5:64689170-64689192 CCGCAGTCTTAACACTGCCCTTA No data
Right 991263245 5:64689201-64689223 ATGGTAAAAGGCTCCTTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991263240 Original CRISPR TAAGGGCAGTGTTAAGACTG CGG (reversed) Intergenic
No off target data available for this crispr