ID: 991263242

View in Genome Browser
Species Human (GRCh38)
Location 5:64689187-64689209
Sequence TTTTACCATATGAAGCTTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991263242_991263245 -9 Left 991263242 5:64689187-64689209 CCCTTAAGCTTCATATGGTAAAA No data
Right 991263245 5:64689201-64689223 ATGGTAAAAGGCTCCTTTGTTGG No data
991263242_991263247 6 Left 991263242 5:64689187-64689209 CCCTTAAGCTTCATATGGTAAAA No data
Right 991263247 5:64689216-64689238 TTTGTTGGTTTGAACTTCAGAGG No data
991263242_991263248 28 Left 991263242 5:64689187-64689209 CCCTTAAGCTTCATATGGTAAAA No data
Right 991263248 5:64689238-64689260 GCCTCAAGATACTCCAAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991263242 Original CRISPR TTTTACCATATGAAGCTTAA GGG (reversed) Intergenic
No off target data available for this crispr