ID: 991263245

View in Genome Browser
Species Human (GRCh38)
Location 5:64689201-64689223
Sequence ATGGTAAAAGGCTCCTTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991263242_991263245 -9 Left 991263242 5:64689187-64689209 CCCTTAAGCTTCATATGGTAAAA No data
Right 991263245 5:64689201-64689223 ATGGTAAAAGGCTCCTTTGTTGG No data
991263243_991263245 -10 Left 991263243 5:64689188-64689210 CCTTAAGCTTCATATGGTAAAAG No data
Right 991263245 5:64689201-64689223 ATGGTAAAAGGCTCCTTTGTTGG No data
991263239_991263245 23 Left 991263239 5:64689155-64689177 CCTAACTGGTTAAAGCCGCAGTC No data
Right 991263245 5:64689201-64689223 ATGGTAAAAGGCTCCTTTGTTGG No data
991263240_991263245 8 Left 991263240 5:64689170-64689192 CCGCAGTCTTAACACTGCCCTTA No data
Right 991263245 5:64689201-64689223 ATGGTAAAAGGCTCCTTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991263245 Original CRISPR ATGGTAAAAGGCTCCTTTGT TGG Intergenic
No off target data available for this crispr