ID: 991263448

View in Genome Browser
Species Human (GRCh38)
Location 5:64690689-64690711
Sequence CCTCGCCGCGCCGGGGGCAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 185}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991263448_991263457 2 Left 991263448 5:64690689-64690711 CCAGTGCCCCCGGCGCGGCGAGG 0: 1
1: 0
2: 0
3: 19
4: 185
Right 991263457 5:64690714-64690736 GCAGCGCTCCAGTATTGCTGCGG 0: 1
1: 0
2: 0
3: 4
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991263448 Original CRISPR CCTCGCCGCGCCGGGGGCAC TGG (reversed) Exonic
900162782 1:1232251-1232273 CCGCGCCGGGCCGGCGGCCCAGG - Exonic
900532504 1:3161636-3161658 CCTCTCCGCGCCGGGCGGGCAGG - Intronic
901743151 1:11355617-11355639 CCTCCCAGCCCGGGGGGCACGGG - Intergenic
902246514 1:15124474-15124496 CCGGGCCGCGCCTGGGGCGCAGG - Intergenic
903340332 1:22650481-22650503 GCTGTCCCCGCCGGGGGCACTGG - Intergenic
903514780 1:23902975-23902997 TCGCGCCGCGCCGGGGCCTCGGG + Intronic
904215390 1:28914757-28914779 CCTCGCCTCACCGGTGGCTCCGG - Intronic
904744470 1:32702630-32702652 CCCCGCCGCGCCGGGGCTCCGGG + Exonic
906411847 1:45584731-45584753 CCTCGCCGGCCCTGGGGCAGGGG + Intronic
906495452 1:46301938-46301960 CCTAGCCGCGCTGGGGACAGGGG - Intronic
906545509 1:46616870-46616892 CCCCGCCACGCCGCGGCCACGGG + Intronic
906961424 1:50421492-50421514 CGTCGCCGCGCCGGGCACGCTGG + Exonic
907158659 1:52356065-52356087 CCTGGCCCCGCTGTGGGCACTGG - Intronic
910338225 1:86156685-86156707 CCTCGGGGCGCCGGCGGCAGCGG + Exonic
910771508 1:90836219-90836241 CCCCGCCCCGCCGGGGGCTGGGG - Intergenic
912471709 1:109911153-109911175 CCTGGGCGCGCCGGCTGCACTGG + Intronic
913518284 1:119623370-119623392 CCTCGCCGCACTCGGGGCACGGG + Exonic
914066851 1:144250429-144250451 CCCGGGCGGGCCGGGGGCACCGG + Intergenic
914112302 1:144715925-144715947 CCCGGGCGGGCCGGGGGCACCGG - Intergenic
916588166 1:166166143-166166165 CCTCGATGCGCGTGGGGCACTGG + Exonic
917846729 1:179026132-179026154 GCCCGCCGCGCCGGGGGCGGGGG - Intronic
922196625 1:223364665-223364687 CCGCGCCGCGCCGCGGGCTGGGG - Intergenic
923506713 1:234610875-234610897 CCTCGCCGCGCCAGTCGCCCCGG + Intergenic
1068669632 10:59709949-59709971 CCTGGCCGGGCCGGGAGCAGCGG - Exonic
1071695287 10:87863508-87863530 CGCCGCCGCGCCGGGAGCCCGGG - Exonic
1072555913 10:96513606-96513628 CCTCGCGGCGCCGGGGGACTCGG - Exonic
1073057848 10:100713635-100713657 CCTGGCCGCGCAGGGGGAGCTGG + Intergenic
1073325842 10:102643724-102643746 TCTCTCCGCGGCGGGGGCGCCGG + Intergenic
1076096215 10:127736763-127736785 ACTCGCCTCGCCGGGGCCCCTGG - Intergenic
1077533311 11:3107303-3107325 CCTCTCCGCACCGGGGCCCCAGG + Exonic
1081831466 11:46119878-46119900 CCTCCCCCCGGCGGGGGCGCGGG + Intronic
1081870696 11:46381464-46381486 CGTCGCAGCGCAGAGGGCACCGG + Intronic
1083478092 11:62926740-62926762 CTTCGCCGGGCTGGGAGCACGGG - Intergenic
1083579060 11:63813473-63813495 CCTCGGCGCGTCGGGAGCCCGGG - Exonic
1084118699 11:67056654-67056676 GCTGGCCGCGCTGGGGCCACGGG - Intergenic
1085035452 11:73297200-73297222 CCACGCCGCTCCTGGGCCACAGG - Exonic
1090230791 11:125102131-125102153 CCTCGCCGCCCCGGAGGCTCTGG + Exonic
1090977174 11:131688176-131688198 CCTCGCGGCTCGGGGGGCGCGGG - Intronic
1096459467 12:51814332-51814354 CCGCGGCGCGCCGGGGGCGCGGG + Intergenic
1096515238 12:52152097-52152119 CCCCGCCGCACCTTGGGCACTGG + Intergenic
1101304394 12:103513188-103513210 CCTTGCCTGGCCGGGGTCACAGG - Intergenic
1102853889 12:116277297-116277319 CGACGCCGCGCCGGGGGCAGCGG + Exonic
1103363667 12:120368343-120368365 CCGGGCCGCTCCGGGGTCACCGG - Intronic
1106516955 13:30464706-30464728 CCTCGCGGCGGCGGCGGCGCAGG - Intronic
1108063302 13:46553512-46553534 ACCCGCCCCGCCGGGGGCGCCGG - Exonic
1112506994 13:99981408-99981430 CCTGACCGCGGCGGGGGCGCCGG - Intergenic
1113463139 13:110495737-110495759 CCTCTGTGCGCCTGGGGCACTGG + Intronic
1118749532 14:68795863-68795885 CCTCACCGCGGCGGGGACGCCGG - Intronic
1119442364 14:74636979-74637001 CCTCTCCCCGCCGGGGGGAAAGG + Intergenic
1122312583 14:100806549-100806571 CCTCTCCCCGCCTGGGGCAGGGG + Intergenic
1122707245 14:103629110-103629132 CCTCGCCCCGCCCGGGGCTGGGG - Intronic
1122801221 14:104230613-104230635 CCTCGCTGCGACGGAGGCCCTGG + Intergenic
1122993245 14:105248789-105248811 TCGCGCCGCGCCGGGGCCTCGGG - Exonic
1128423982 15:67521225-67521247 GCCCGCCGCGCCGGGGACGCAGG - Exonic
1130270792 15:82445847-82445869 GCTCGCCCCGCCTGGGGAACCGG - Intergenic
1130463132 15:84173170-84173192 GCTCGCCCCGCCTGGGGAACCGG - Intronic
1130489542 15:84421618-84421640 GCTCGCCCCGCCTGGGGAACCGG + Intergenic
1130501133 15:84500380-84500402 GCTCGCCCCGCCTGGGGAACCGG + Intergenic
1132476319 16:140186-140208 CCTCTCAGCGCTGGGGTCACAGG - Intergenic
1132519627 16:381394-381416 CTTCCCCGCGCCGGGCGCGCCGG + Intronic
1132583070 16:694152-694174 CCGCGCTGGGCCGGGGGCGCGGG + Exonic
1134554637 16:15154801-15154823 CCGCGCCGCGCGGGGCGGACGGG + Intergenic
1136110844 16:28063021-28063043 CCGCGCCGCCCCGGGGGAGCCGG + Intronic
1136153576 16:28367831-28367853 CCACGCCTCGCCTGGGGCCCAGG + Intergenic
1136351525 16:29711677-29711699 CCACGCCCAGCCGGGGGCAGTGG - Intergenic
1137056618 16:35749246-35749268 CCGGGCCGCGGTGGGGGCACAGG - Intergenic
1142263084 16:89051546-89051568 CCTGGCTGTGCCGGGGGCTCTGG - Intergenic
1142287546 16:89177549-89177571 CCTAGCCAGGCCCGGGGCACAGG + Intronic
1142428194 16:90011773-90011795 CCTCTCCGCCCAGAGGGCACAGG + Intronic
1142711143 17:1724752-1724774 CCCCGCCGCGCCCGGAGCGCAGG + Intronic
1142742068 17:1937080-1937102 CCTGGCCCCGCTGGGGGCCCTGG - Exonic
1142757579 17:2025035-2025057 CAGCCCCGCGCCGAGGGCACCGG + Exonic
1146034059 17:29390718-29390740 CGTCGCCGCCTCGGGGGAACCGG - Exonic
1146183100 17:30709532-30709554 CCTCGCGGCGGCGGAGGCTCGGG - Intergenic
1146762421 17:35490092-35490114 CTGCTCCGCGCCTGGGGCACTGG - Intronic
1148000840 17:44386043-44386065 CCTCGGCCCTCCAGGGGCACAGG + Exonic
1150643533 17:66964823-66964845 GCGCGCCGCTCCGGGGGCGCCGG - Intergenic
1151404537 17:73878026-73878048 CCTCTCCTCCCCTGGGGCACAGG - Intergenic
1151582387 17:74987818-74987840 TCCCGCAGAGCCGGGGGCACCGG - Exonic
1151866432 17:76806256-76806278 CCCCGCCGCCCCGCCGGCACGGG + Intergenic
1152225352 17:79090274-79090296 CCTCGCCAGGCTGGGGGCACGGG + Intronic
1152468051 17:80476705-80476727 CCCCGCCGCGCCGCGGGCCCGGG - Intronic
1152727987 17:81957060-81957082 CCTTGCAGCGCGGGGGGCACCGG - Exonic
1152748450 17:82051774-82051796 GCTCGCAGCGCCGGGGGTCCCGG - Exonic
1155152862 18:23136125-23136147 GCTCGCCGCGCCGGGCACGCCGG + Exonic
1155928937 18:31685569-31685591 CCTCCCCGCGCCCGCCGCACCGG + Intronic
1157374484 18:47150505-47150527 CCTGGCCGCGCCGGAAGCCCCGG + Exonic
1158505548 18:58044045-58044067 CCGCGCCGCGCTGGAGGCCCCGG + Intergenic
1158649344 18:59272672-59272694 CCCCGCCTCGCTGTGGGCACTGG + Intronic
1160719247 19:590199-590221 GCTCGCCGCGCCCGGGGTGCCGG - Exonic
1160730778 19:640796-640818 CCCCGCCGGGCGGGGGGCACTGG + Intronic
1160864281 19:1250230-1250252 CCTCGCCGCGCCTCCGGGACAGG - Exonic
1160966652 19:1749683-1749705 GCTCGCCGCGGCGGGGGCAACGG + Intergenic
1161009600 19:1953922-1953944 CCTCACCGCGCCGACTGCACCGG - Intronic
1161069165 19:2251951-2251973 CCGCGCGGCGCAGGGGTCACCGG - Exonic
1161083191 19:2321662-2321684 CCTAGCCTGGCCGGGGGCGCGGG - Exonic
1161248998 19:3270594-3270616 CCCGGCCGCCCCGGGCGCACAGG - Intronic
1162527472 19:11214723-11214745 CCTGGCAGCCCAGGGGGCACTGG + Intronic
1162779957 19:13001896-13001918 CCACGCCAGGCCAGGGGCACGGG - Intronic
1162975694 19:14206236-14206258 CCTCGCGGCGGCGGAGGCTCGGG + Intergenic
1163158208 19:15450071-15450093 CCTCGCCGCCCCGGGGGGGGCGG + Intergenic
1163426945 19:17245314-17245336 CCCCGGCGCGCGGGGGGCACGGG + Exonic
1166798784 19:45443683-45443705 CCTGGCCGGGCCGGGGACAATGG + Intronic
1166855861 19:45782376-45782398 CCTCCCCGGGCCGGGGGCTCGGG + Intronic
927215858 2:20667456-20667478 GCGCGCCGCGCCGCGGGCTCCGG + Exonic
927652343 2:24920201-24920223 CCGCGCGGCGCCGGCGGCTCCGG + Intergenic
929777620 2:44938728-44938750 CCCCGCCGGGCTGGGGGCGCAGG - Intergenic
929886493 2:45883477-45883499 CCCCGTCGTGCTGGGGGCACAGG + Intronic
934553510 2:95276025-95276047 CCCCGCAGCGCCGGTGGCAGCGG - Exonic
936141848 2:109947806-109947828 CCTCGCCGGGCTGCGGGCGCAGG - Intergenic
936178536 2:110245754-110245776 CCTCGCCGGGCTGCGGGCGCAGG - Intergenic
936202842 2:110423678-110423700 CCTCGCCGGGCTGCGGGCGCAGG + Exonic
936279124 2:111122572-111122594 CCTCCCCGCGCCGCTGGCGCCGG - Intronic
936439956 2:112542688-112542710 CCTCGCCGCGGCAAGGGCGCCGG - Intronic
937252520 2:120533743-120533765 CCTGTCCACGCCGGGGGCTCAGG - Intergenic
937288448 2:120767637-120767659 CCTCTCAGAGCGGGGGGCACAGG - Intronic
940978021 2:159968589-159968611 CCTCTCCTGGCCTGGGGCACAGG + Intronic
942565599 2:177263533-177263555 CCTCGCCGCGCCAGGGCCAAGGG - Intronic
947712838 2:232325820-232325842 CCTCCCAGCACCAGGGGCACAGG - Intronic
947732521 2:232439263-232439285 CCTCCCAGCACCAGGGGCACAGG - Intergenic
1170991237 20:21303507-21303529 CCTAGACGTGCCGGGGGCCCGGG - Intronic
1171213062 20:23331689-23331711 CCTGGCCCCGCTGGGGGCTCTGG + Intergenic
1171977614 20:31605514-31605536 TCGCGCTGCGCCGGGGGCGCCGG + Exonic
1172539348 20:35699135-35699157 CGTCGCCGCGCGGAGGGGACAGG + Intronic
1176156983 20:63626915-63626937 CCTCGCCGCGGGGGGGCCGCGGG + Intronic
1176549491 21:8214997-8215019 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
1176557386 21:8259226-8259248 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
1176568416 21:8398031-8398053 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
1176576328 21:8442261-8442283 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
1177792252 21:25734508-25734530 CCTACCCGCCCCGGGCGCACGGG - Intronic
1177932519 21:27302518-27302540 CCTCGCCTGGCCGGGTGCAGTGG + Intergenic
1180067301 21:45418818-45418840 CCTCGCAGGGCCGCAGGCACAGG - Intronic
1181141865 22:20811454-20811476 CCTCTCCGGGCCAGGTGCACTGG + Intronic
1181168307 22:20994809-20994831 CCTCGCCCAGCCTGGGGCCCTGG + Intronic
1182440711 22:30362366-30362388 CCTCGCCCGGCCTGGGGCCCTGG + Intronic
1183665070 22:39242393-39242415 CCTCGCCTCGCCGTGGGACCTGG - Intronic
1184086633 22:42269918-42269940 CCTGGCAGCCCCGGGGGCACCGG - Intronic
1184643434 22:45883992-45884014 CCTCACCCAGCCGTGGGCACAGG + Intergenic
1184718753 22:46296966-46296988 CCGCGCCGCACCGGGCCCACCGG - Intronic
1185094578 22:48799377-48799399 CCTAGCCACGCCTGGGGCCCCGG - Intronic
1185343089 22:50300159-50300181 CCTCACCAGGCCGGGGGCCCAGG + Intronic
1185385718 22:50530602-50530624 CCTCTCCGCGCCGGGACCCCTGG + Intronic
1203254378 22_KI270733v1_random:131319-131341 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
1203262434 22_KI270733v1_random:176398-176420 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
954256615 3:49411844-49411866 CCTCTTCGCGCCGGGGACGCCGG + Exonic
954304624 3:49719060-49719082 CCTCGACGGGCTGGGGGCGCTGG - Exonic
954656634 3:52198041-52198063 CCTCGGCGAGCCGGGGGGGCGGG - Intergenic
956452266 3:69386275-69386297 CCTCGATGCTCCCGGGGCACGGG + Intronic
963882680 3:150546227-150546249 CCTCGGCGCTCCGGCGGCGCGGG - Exonic
966379078 3:179325306-179325328 CCTCACCTCGCCGGGTGCAGTGG - Exonic
970333183 4:15004352-15004374 CCTGGCCGCGCCGCGGGACCGGG + Intronic
970333319 4:15004756-15004778 CCTCCCCGCGTCGGGGGTCCGGG - Intronic
973982092 4:56315418-56315440 CCTCGCGTCGCCGGGGCCTCGGG - Exonic
980923943 4:139115456-139115478 GCTCGCCGCGGCGAGGGCAGCGG + Intronic
983998802 4:174216604-174216626 CCTCGCTGAGCCGGGAGGACTGG - Intergenic
985550183 5:528785-528807 CCTCCCCCCGCCCGGGGCTCCGG + Intergenic
985716200 5:1463372-1463394 CCCTGCCGGGCGGGGGGCACCGG - Exonic
986184510 5:5423012-5423034 CCCCCCCGCGCCCGGGGCCCCGG - Intronic
987035157 5:14011843-14011865 CCGCGCCGCGCTGGGGGCGGTGG - Intergenic
991198434 5:63961721-63961743 CCTTCCCGCGCCGGGCGCGCAGG - Exonic
991263448 5:64690689-64690711 CCTCGCCGCGCCGGGGGCACTGG - Exonic
992828153 5:80569742-80569764 CCTCGCCGAGCGGCGGGAACCGG - Intronic
1002925823 6:1605160-1605182 CCTCACCCCGCCGGCGGCTCCGG + Intergenic
1003995715 6:11537924-11537946 CAGCGCCGCGCCGCGGGGACTGG - Intergenic
1004340488 6:14803810-14803832 CATCCCCACGCCTGGGGCACAGG + Intergenic
1004690472 6:17988095-17988117 GCTCGCCGCGCTGGGTGCGCAGG + Intergenic
1004924087 6:20402489-20402511 CTGCTCCGCGCCGGGGGCACTGG - Exonic
1006171653 6:32096700-32096722 CCTCGCAGCGCCCGCGGCCCCGG + Intronic
1006547517 6:34792147-34792169 CCTCGCCGCGGCGTGAGCACCGG - Exonic
1018612932 6:165661768-165661790 CCGCGCTCCGCCAGGGGCACCGG + Intronic
1020085502 7:5308061-5308083 CCTGGCCGCCCTCGGGGCACAGG + Exonic
1020281631 7:6653096-6653118 CCCCGCCGCGTCGGTGGCGCTGG - Exonic
1023872218 7:44269327-44269349 CCTTCCCCCGCGGGGGGCACTGG - Intronic
1024524383 7:50336242-50336264 CCTGGCCCCGGCGGGGGCAGGGG + Intronic
1025208807 7:57009182-57009204 CCTGGCCGCCCTCGGGGCACAGG - Intergenic
1025663144 7:63567688-63567710 CCTGGCCGCCCTCGGGGCACAGG + Intergenic
1028135639 7:87220396-87220418 CCTGGCCGCGCCGGGGAGAGTGG + Exonic
1029640512 7:101816679-101816701 CTCCGCCGCGCCGGCGGCAGTGG - Intronic
1032089244 7:128903017-128903039 CCTCACCCTGCCTGGGGCACTGG - Intronic
1033165573 7:139036034-139036056 GCTCGCTGCGCCGCGCGCACAGG - Intergenic
1033299811 7:140176335-140176357 CCCCGCCGCGCCCGGGGCTCCGG - Intronic
1034560626 7:151877329-151877351 CCCCGCCGCGCCGCGGCCCCAGG + Intergenic
1035719818 8:1783602-1783624 CCTCGCCGCGCTGCGGGGGCTGG + Exonic
1037811385 8:22089155-22089177 CCTCGTCGCGCCGGGGCCGCCGG + Intronic
1038268071 8:26051158-26051180 CCTCGCCGCGTAGGGGTCGCTGG + Intergenic
1038304035 8:26383286-26383308 CCGCGCCGCGCCGGTGGCGGCGG - Intronic
1042532897 8:69833099-69833121 CCTCGCTGCGCCAGGGGTACCGG + Exonic
1049013209 8:139901784-139901806 CGTGGCAGAGCCGGGGGCACGGG - Intronic
1049341327 8:142114123-142114145 CCTGGCCGGGCCGGGGGCTGAGG + Intergenic
1049519137 8:143079417-143079439 TCCCGCCTCACCGGGGGCACAGG - Intergenic
1049752491 8:144291768-144291790 CCCCGCCGCGCCGGGGCCCACGG - Exonic
1057488635 9:95506109-95506131 ACTCTGCGCGCCGGGGGCCCCGG - Intronic
1057773282 9:97984832-97984854 CCGCCCCGCGCCGGGCGCGCGGG + Intronic
1062346682 9:136118367-136118389 CCGCGCCGCGCCGGGCCCCCTGG + Intronic
1062414153 9:136439489-136439511 CCTCGCTGCGCCGGCGACCCCGG - Exonic
1062462090 9:136666301-136666323 CCTGGCTGCGCCGCAGGCACTGG - Intronic
1203470779 Un_GL000220v1:114463-114485 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
1203478600 Un_GL000220v1:158435-158457 CGTCGCCGGGGCGGGGGCGCGGG - Intergenic
1187464469 X:19515211-19515233 GCTCGCCGCCCCGAGGGCCCCGG + Exonic
1187915441 X:24149470-24149492 CCTCGCTGCGGCGGGGTCTCCGG - Intronic
1190265750 X:48826562-48826584 CCTGGCAGGGCCAGGGGCACCGG - Intergenic
1190285308 X:48957476-48957498 CGCCGCGGCGCCGGGGGCATCGG + Exonic
1200097974 X:153673113-153673135 CCCCGCCCCGCCGGGGGCAAGGG + Intronic
1202372061 Y:24205442-24205464 GCTCGCCCCGCCTGGGGAACCGG + Intergenic
1202498724 Y:25464674-25464696 GCTCGCCCCGCCTGGGGAACCGG - Intergenic