ID: 991266376

View in Genome Browser
Species Human (GRCh38)
Location 5:64723981-64724003
Sequence CACCTTCCAATGATGAAGCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 145}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991266376_991266380 12 Left 991266376 5:64723981-64724003 CCTTGCTTCATCATTGGAAGGTG 0: 1
1: 0
2: 2
3: 17
4: 145
Right 991266380 5:64724016-64724038 AGCAATACTCATTAACTGCTAGG 0: 2
1: 1
2: 1
3: 7
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991266376 Original CRISPR CACCTTCCAATGATGAAGCA AGG (reversed) Exonic
900021752 1:190277-190299 CTCCTTCCAGTGAGGAAGCGGGG + Intergenic
901838196 1:11937600-11937622 CAGCTGCCCATGATGAAGCCCGG + Intronic
902721010 1:18303987-18304009 CACTGCCAAATGATGAAGCAGGG + Intronic
904971953 1:34426253-34426275 CACATTCCAACCAGGAAGCAGGG - Intergenic
911787087 1:101964656-101964678 CACCTCACAATCATGAAGAAAGG + Intronic
913114126 1:115681183-115681205 CACCTTGCAATGATACAGCAAGG - Intronic
916829384 1:168475364-168475386 CATCTTACTATGATGGAGCAGGG - Intergenic
924311785 1:242751337-242751359 CACATTGCAATTATAAAGCATGG - Intergenic
924674210 1:246159353-246159375 AGCCTTCCAGTGATGAAGAATGG + Intronic
1064703215 10:18044014-18044036 CACTATCCAGTGATGATGCATGG - Intergenic
1067904819 10:50279817-50279839 GACCTTCCAAGGATGGTGCAGGG - Intergenic
1068197929 10:53743719-53743741 CATCTTACATTGCTGAAGCAAGG + Intergenic
1073292306 10:102419322-102419344 CACCCTCCCAGGATGCAGCAGGG + Intronic
1077454885 11:2672533-2672555 CACCTTCCAATGTGGAAGACAGG - Intronic
1079391648 11:20027085-20027107 CACCTTCAAAGAATGAAGCAGGG - Intronic
1085514673 11:77105313-77105335 CACCTTCCAAGGAGGAGGCCTGG + Intronic
1086867481 11:91997779-91997801 CACTTGCCCATAATGAAGCAAGG + Intergenic
1088044938 11:105438700-105438722 AACCTTCCAATAATCAAGCAAGG - Intergenic
1089633228 11:119796389-119796411 CACTTTCCTATGATGGGGCAGGG + Intergenic
1091375095 12:19789-19811 CTCCTTCCAGTGAGGAAGCGGGG + Intergenic
1092883158 12:12903629-12903651 CACCTCCCAATCATGCAACAGGG - Intronic
1092993114 12:13922324-13922346 CACCTTCCATTGTGGAAGCGGGG - Intronic
1093522514 12:20067171-20067193 CCCCATCCAATGAGGAAGGATGG - Intergenic
1094639056 12:32255542-32255564 AATCTTCTAATGATGAGGCATGG + Intronic
1096090703 12:48898658-48898680 CACCTTGCAAGGCTGGAGCATGG + Intergenic
1097913261 12:64993394-64993416 AACCTTCACATGAAGAAGCAAGG - Intergenic
1100304943 12:93341823-93341845 CACATTCCAATAATGAAACAAGG - Intergenic
1107772052 13:43797738-43797760 CACATTCAAATAATTAAGCATGG - Intergenic
1111174853 13:84580868-84580890 CACTATCCAATGATCATGCAAGG - Intergenic
1111192432 13:84826896-84826918 CATGTTCCAATGAAAAAGCATGG + Intergenic
1112116284 13:96358834-96358856 AACCTTCAAATGATTAAGAAAGG + Intronic
1112291874 13:98151115-98151137 CACCTTCTCATAATGAAGAAGGG - Intronic
1112854150 13:103745798-103745820 CACTGTGGAATGATGAAGCAAGG - Intergenic
1112854957 13:103757160-103757182 CACCTTCCCATGTTGAATCATGG - Intergenic
1116863145 14:50010388-50010410 CACCTAGCTATGATGAAGGAAGG - Intergenic
1117013747 14:51497012-51497034 CACCATACAATGTTGAAACAGGG + Intronic
1119192464 14:72692411-72692433 CAACTTCCAATTATGAATTAGGG - Intronic
1119918911 14:78427864-78427886 GACCTTCCACTGAAGAAGAAAGG + Intronic
1120644941 14:87062894-87062916 CATCTTCCCATGGTGGAGCAGGG + Intergenic
1121237087 14:92399836-92399858 CACCCTCCAATGCTCAAACAAGG - Intronic
1121694803 14:95904040-95904062 TCCCTTCCAATCATGAGGCAGGG - Intergenic
1123892943 15:24799586-24799608 GACCTTCCAATGGTTAAGAATGG - Intergenic
1125335922 15:38626186-38626208 CAGCTTCCAAAGATGAAGAGTGG - Intergenic
1125378373 15:39058937-39058959 CACCCAGCAATGATGAAACATGG + Intergenic
1126555122 15:49978501-49978523 AACCTAGCTATGATGAAGCAAGG - Intronic
1132451480 15:101971185-101971207 CTCCTTCCAGTGAGGAAGCGGGG - Intergenic
1132455411 16:19443-19465 CTCCTTCCAGTGAGGAAGCGGGG + Exonic
1135908955 16:26541876-26541898 CACCTTCAGAGGCTGAAGCAGGG - Intergenic
1136858534 16:33680702-33680724 CACCTTCCAGTGTTGGCGCACGG + Intergenic
1137560025 16:49496499-49496521 AAGCTTCCAATGATGATGGAAGG - Intronic
1140824014 16:78689236-78689258 AACCTTCCAATGGTGACGTATGG - Intronic
1146555902 17:33823763-33823785 AAACTTCCAATGCTGAAGCCTGG - Intronic
1147385556 17:40079356-40079378 CAGCTACCAATGCTGAAGCAGGG - Intronic
1147520199 17:41163785-41163807 CACCAGCCAGTGCTGAAGCAGGG - Intergenic
1147712247 17:42477128-42477150 CTCTTTCCAAGGAAGAAGCAAGG - Intronic
1148807477 17:50271256-50271278 CATCTTCCAATGAAGAAGTGAGG - Intergenic
1148873892 17:50675351-50675373 CACCTTCCAACGCTGCAGTAGGG - Exonic
1156613186 18:38751661-38751683 CAGCTTCTCAGGATGAAGCAGGG + Intergenic
1158458972 18:57631147-57631169 CAGCTTGCAATCATGAAGCCTGG - Intergenic
1160633783 19:61362-61384 CTCCTTCCAGTGAGGAAGCGGGG + Intergenic
1161694344 19:5757739-5757761 CACCTTCAAATGAAAAATCAGGG - Intronic
1162228366 19:9243728-9243750 CACTTTCAAAGGATGATGCAAGG - Intergenic
1164826795 19:31290031-31290053 CACCTTGCTATGATGAAGCAAGG + Intronic
930318403 2:49825053-49825075 CACCCTCCAAAGATTAAGCCAGG - Intergenic
937566376 2:123294735-123294757 CACCCGCCTATGATGAAGGATGG + Intergenic
941731009 2:168917710-168917732 CACATTCCAATGGAGAAGCTGGG + Intergenic
944691097 2:202159191-202159213 CATCATCCAAAGATGGAGCAGGG + Intronic
946473234 2:219982427-219982449 CACTTTCCAGTGACCAAGCATGG + Intergenic
947858567 2:233341821-233341843 CACTTTAAAATGATGAAGCTGGG + Intronic
1169891623 20:10459509-10459531 CATCTTTAAAAGATGAAGCAAGG - Intronic
1170746917 20:19107670-19107692 CTCCTTACAATAATGAAGCCTGG - Intergenic
1177336901 21:19740531-19740553 CACCTTGAAGTGATGAAGCTAGG + Intergenic
1178160779 21:29911725-29911747 CATCTTCCTATGATGGAGGAGGG - Intronic
1178792959 21:35717109-35717131 GACACTCCAATGATGAAGCCTGG - Intronic
1181843958 22:25690986-25691008 CAACTTGCACTGATCAAGCAGGG - Intronic
1182861235 22:33561263-33561285 CGCCTTCCATTGAAGAACCAGGG + Intronic
1182997233 22:34825413-34825435 CACCCTCAAATGAAGCAGCATGG - Intergenic
951239020 3:20268529-20268551 CACCTTCCCAAGATTAAGCCAGG - Intergenic
952039901 3:29249353-29249375 AAGCTTCCAATTATGGAGCACGG - Intergenic
953163704 3:40445334-40445356 CCCGCTCCAATCATGAAGCAAGG + Intergenic
955508664 3:59657770-59657792 CTCCTTCCACTGCTGAACCAAGG - Intergenic
956042683 3:65162000-65162022 CAACTTCCAGAGATGAAGCAAGG + Intergenic
956572349 3:70711446-70711468 CATCTTACAATGATGGAGCAGGG + Intergenic
962082996 3:132160482-132160504 CACCAACCAATGACTAAGCAAGG + Intronic
962961707 3:140317239-140317261 CACATTCAAAGGATGATGCAAGG - Intronic
963461232 3:145617209-145617231 CACCTACCAATGAGGAAGGATGG + Intergenic
964980115 3:162668188-162668210 CACCCTTTAATAATGAAGCAAGG + Intergenic
965693854 3:171386044-171386066 CTCCTTCCAAAGCTGAAGCTGGG + Intronic
966631319 3:182078443-182078465 CACCTTCCAGTGATGCGGGAAGG + Intergenic
967407401 3:189132943-189132965 GACCTTCTAATGAGGAAGCGGGG + Intronic
968113325 3:196068365-196068387 CACCTTGCAAGGCTGAGGCAGGG + Intronic
971182111 4:24338309-24338331 CCTCTTCCAATGAAGAAGAAAGG + Intergenic
971761645 4:30773613-30773635 CAACTTCCACTGAAGAATCATGG + Intronic
973131917 4:46658417-46658439 CAGTATGCAATGATGAAGCATGG + Intergenic
973665020 4:53150362-53150384 CATCTGCCCAAGATGAAGCAAGG + Intronic
975838542 4:78450252-78450274 CGCCTGCAGATGATGAAGCATGG + Intronic
976070494 4:81234679-81234701 CACCATGCAAAGAAGAAGCAAGG - Intergenic
977166635 4:93707412-93707434 AACCTACCAAGGTTGAAGCAGGG - Intronic
979937878 4:126720502-126720524 CACCTTCCACTGAGGGATCATGG - Intergenic
980245352 4:130232111-130232133 CACTTAGCAATGATGAAGGAAGG - Intergenic
985216185 4:187656847-187656869 CACCTGACAATGATGAAGATAGG + Intergenic
987204715 5:15613373-15613395 CCACTTCCAAAGATGAACCATGG + Intronic
988899677 5:35718585-35718607 CACCTTGCACCCATGAAGCAGGG + Intronic
989340180 5:40365232-40365254 CACCTTGCAAGGCTGAGGCAAGG + Intergenic
991266376 5:64723981-64724003 CACCTTCCAATGATGAAGCAAGG - Exonic
992393702 5:76352550-76352572 CACCATGAAATGATGAAGCAAGG + Intronic
995460042 5:112393519-112393541 CACCTTCCCAAGATGAAACCAGG + Intronic
995857677 5:116610627-116610649 CACCTTCTCATGCTGAACCATGG - Intergenic
996588273 5:125116050-125116072 CATCTTCCTCTGATGAAACAGGG + Intergenic
998467704 5:142358721-142358743 CACCTAGAAATGATGGAGCAGGG + Intergenic
998502465 5:142645401-142645423 CACCTTCCAATATTGACTCAGGG - Intronic
998622048 5:143805480-143805502 CAACTTCTAATGAAGATGCATGG - Intergenic
999067005 5:148698040-148698062 CTCCATCCAATGATGAAATAGGG + Intergenic
999789924 5:154929780-154929802 TACCTACCACTGATGAAGCCTGG + Intronic
1001788840 5:174437204-174437226 CCCCTCCCAATGAGGAAGGATGG - Intergenic
1004372045 6:15061083-15061105 CAGCTTCCAATAAAGAACCATGG - Intergenic
1004916423 6:20336712-20336734 CACCTAGCCATGATGAGGCATGG - Intergenic
1008557653 6:52690058-52690080 CACCTTCTAGTGATGAAGCGAGG + Intergenic
1009060050 6:58387675-58387697 CACCCCCCAATGAGGAAGGATGG - Intergenic
1010647186 6:78403908-78403930 CACCTCCCAAGATTGAAGCAGGG - Intergenic
1010672468 6:78702658-78702680 CACCTTTCAAGGATGGAGAAGGG - Intergenic
1010909196 6:81532485-81532507 CACATTCCATTGATGGAGTAAGG + Intronic
1011664986 6:89624705-89624727 CACCTTGCAATTAGGAAGCTGGG - Intronic
1011672760 6:89699598-89699620 TACCTTCTGATGATGCAGCAAGG + Exonic
1011723791 6:90187455-90187477 CACCGTGCAGTCATGAAGCAGGG + Intronic
1012519517 6:100104070-100104092 CAACTTCCGAGGATGAAGCTGGG - Intergenic
1017750520 6:157486959-157486981 CACCTACCAATGCTGTAGCTGGG - Intronic
1020566733 7:9807270-9807292 CGCCATCAAATGATGAAACAAGG + Intergenic
1022205064 7:28155842-28155864 CATCTTCCCAGGAAGAAGCAGGG - Intronic
1023361848 7:39425190-39425212 CAATTACAAATGATGAAGCAGGG - Intronic
1024002022 7:45196253-45196275 CAGCTCCAAATGGTGAAGCAGGG + Intergenic
1026158808 7:67851104-67851126 CACCTTCCAAACAAGAATCATGG - Intergenic
1026958853 7:74395904-74395926 CACCTTGCAATCATGAGGCGGGG - Intronic
1028023982 7:85813588-85813610 CATCTTTACATGATGAAGCAGGG + Intergenic
1029180646 7:98699023-98699045 CCCCTTCCAAGGAAGAAGCAAGG - Intergenic
1035482622 7:159199487-159199509 GAGCTTCCAAAGATGAAACATGG + Intergenic
1036080872 8:5554000-5554022 CAGCTTCTTATGATGAAGGAGGG + Intergenic
1036780779 8:11645772-11645794 CCCCTTCGCAGGATGAAGCAGGG + Intergenic
1036987326 8:13549692-13549714 GACCTTCCAATTCTGAAGCCAGG - Intergenic
1038154048 8:24970784-24970806 CACCTTACCATGGTGAAGCAGGG + Intergenic
1043784192 8:84376551-84376573 CATCTCCCATTGAGGAAGCAGGG + Intronic
1045720430 8:105103400-105103422 CATCTTCCAAAGATGGAGAATGG - Intronic
1046483166 8:114850525-114850547 CACTATCCAATGGTGAAGGAAGG + Intergenic
1047183218 8:122608773-122608795 CACCTTCCAGGGTTGCAGCAAGG - Intergenic
1049378743 8:142301573-142301595 CACCTTCCTAAGGTGAAGGAAGG - Intronic
1049884840 9:19867-19889 CTCCTTCCAGTGAGGAAGCGGGG + Intergenic
1051462832 9:17342741-17342763 CTCATTCCAAAAATGAAGCACGG - Intronic
1052050129 9:23836999-23837021 CTCCTTGCAATGAGGAGGCAGGG + Intergenic
1052152727 9:25139026-25139048 CTCCTTCCATAAATGAAGCAAGG + Intergenic
1052617039 9:30854662-30854684 CAGCTTGCACTCATGAAGCAGGG - Intergenic
1053158499 9:35796778-35796800 CACCTTCCAATGGGGAAGCAGGG + Intronic
1053523470 9:38805479-38805501 CATCTTCCAAGCATGAAGCAAGG - Intergenic
1054195699 9:62029898-62029920 CATCTTCCAAGCATGAAGCAAGG - Intergenic
1054642709 9:67558791-67558813 CATCTTCCAAGCATGAAGCAAGG + Intergenic
1056567118 9:87783465-87783487 CACGTTCCATTGATGATGAAAGG - Intergenic
1060069702 9:120535206-120535228 CACCTCCAAATGCTGAAGCTAGG + Intronic
1185728412 X:2441659-2441681 GACCTTCCACTGATTAGGCAAGG + Intronic
1187425910 X:19176885-19176907 CACCTTCCATTGTTGAGGGAGGG + Intergenic
1193780778 X:85698912-85698934 CCCCTTCCAATGAAGAAGGATGG + Intergenic
1194933415 X:99917093-99917115 CTCCTTCCAACACTGAAGCATGG - Intergenic
1195619632 X:106939950-106939972 CTCATTCTAATGATGAAGCCTGG + Intronic
1196373543 X:115004800-115004822 CACATGCAAATGATAAAGCATGG - Intronic
1197852584 X:130879052-130879074 CAACTTCCAATGAATAAGCTGGG + Intronic
1198589757 X:138164549-138164571 CACTTTACAATGAAGAAGCCTGG - Intergenic
1200400968 X:156020285-156020307 CTCCTTCCAGTGAGGAAGCGGGG - Intergenic