ID: 991266466

View in Genome Browser
Species Human (GRCh38)
Location 5:64725575-64725597
Sequence TCGGAGTCACTAAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 107}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991266466 Original CRISPR TCGGAGTCACTAAAGGAGGA AGG (reversed) Intronic
902444422 1:16452885-16452907 TAGGAATCAGTAAAGCAGGAAGG - Intronic
903645526 1:24893634-24893656 TCAGAGTCAATAAAGGCGAATGG + Intergenic
903875749 1:26472261-26472283 TCGAAGGCAGTAAATGAGGAGGG - Intergenic
904287879 1:29464228-29464250 TTGGAGTCTCTGAAGGAGGCAGG - Intergenic
906288265 1:44602628-44602650 CGGGAGTCAGTGAAGGAGGAGGG - Intronic
908605010 1:65788903-65788925 TTGGAGTCTCTAAAGAAGAATGG - Intergenic
912768219 1:112436281-112436303 TAGAAATCATTAAAGGAGGAAGG + Intronic
915168547 1:153962442-153962464 GGGGAGTGACCAAAGGAGGAGGG - Intronic
915847086 1:159277745-159277767 TGGGAATCCCTAAAGGTGGAAGG - Intergenic
917301341 1:173577621-173577643 ACGGGGCCACTAATGGAGGAAGG - Intronic
923168912 1:231394928-231394950 TCAGAGGCACTATAGGAGGCAGG - Intronic
1064414772 10:15139428-15139450 TCACAGTCACTAGAGGTGGAAGG + Intronic
1066796967 10:39133000-39133022 TTGGAGTCCCTTAAGGAGTATGG + Intergenic
1074106392 10:110392679-110392701 TGGGAGTCACAAAAGGGGCATGG + Intergenic
1076473437 10:130736101-130736123 TAGGAGTGACCAAAGGATGATGG + Intergenic
1076473457 10:130736209-130736231 TAGGAGTGACCAAAGGATGATGG + Intergenic
1082919490 11:58477704-58477726 TTGAAGTCAATAAAGAAGGAAGG - Intergenic
1086371126 11:86156680-86156702 TCTGGGTAACAAAAGGAGGAGGG + Intergenic
1089883830 11:121800528-121800550 TGGGAGACAGGAAAGGAGGAAGG + Intergenic
1091556654 12:1578832-1578854 TCTGACTCCTTAAAGGAGGAGGG - Intronic
1093110814 12:15149865-15149887 TCATAGTCACGAAACGAGGATGG - Intronic
1093209670 12:16293047-16293069 TCGAGGTCACTAAAGGAGGGTGG + Intergenic
1094176392 12:27546107-27546129 TGGGAGTCACAAAGGGAGGAGGG + Intronic
1094353379 12:29551051-29551073 TAGAAGTAACTAAAGGTGGAGGG + Intronic
1095951147 12:47782615-47782637 TCTGAGTCACTGCCGGAGGAGGG - Exonic
1099684154 12:85864811-85864833 TTGGAGTAACTGAAGGAGGCAGG - Intergenic
1100456978 12:94761706-94761728 TGTGAGTCACTAGAGGAGGATGG - Intergenic
1105323961 13:19353435-19353457 TCGGGCTCGCTAAGGGAGGAAGG - Intergenic
1105323975 13:19353548-19353570 TCGGGCTCGCTAAGGGAGGAAGG - Intergenic
1105323989 13:19353661-19353683 TCGGGCTCGCTAAGGGAGGAAGG - Intergenic
1105869977 13:24495987-24496009 TCGGGCTCGCTAAGGGAGGAAGG + Intronic
1119344235 14:73909049-73909071 TGGGAGTCACTGAAGAAGGTAGG + Intronic
1121107502 14:91290705-91290727 CTGGAGTCACTCAAGCAGGATGG - Intronic
1122317323 14:100833879-100833901 ACAGACTCACTAAGGGAGGAAGG - Intergenic
1126765148 15:52004149-52004171 TCTGAGTCACAGAGGGAGGAGGG + Intronic
1129785082 15:78304532-78304554 TGGAAGTCTCTACAGGAGGAGGG - Intergenic
1130332732 15:82934396-82934418 TGAGGGTCACTAAAGGAGCATGG - Intronic
1139558881 16:67729343-67729365 TCGGAGTAATTGACGGAGGATGG + Exonic
1141707867 16:85678658-85678680 TCTGAAGCACTAAAGGAGCAAGG + Exonic
1146492621 17:33293121-33293143 TCGGAGTCTCGAGAGGAGAAGGG - Intronic
1151698693 17:75731232-75731254 GCGGATCCGCTAAAGGAGGAAGG - Exonic
1156538528 18:37887272-37887294 GCAGAGTCAGTAAAGGGGGAGGG - Intergenic
1158751806 18:60270812-60270834 TCAGAGTGACAAAAGAAGGATGG + Intergenic
1162370770 19:10277804-10277826 TCGAAGTCCCCAAAGTAGGAAGG - Intronic
1162718540 19:12648341-12648363 TCGGAGCCACTAATGGAGAACGG - Exonic
1164875643 19:31684840-31684862 TTGGAATCACTAAGGGAGAAAGG - Intergenic
1165843276 19:38802223-38802245 TCTGAATCCCTAAAGGAGGAGGG + Intronic
925609583 2:5692268-5692290 TCCGAGTTAATAAAGGAAGATGG + Intergenic
928192395 2:29184559-29184581 TCTTAGACACGAAAGGAGGAAGG + Intronic
928294283 2:30069433-30069455 TCGGAATGACTGAGGGAGGATGG - Intergenic
928943632 2:36752660-36752682 TAGGAGACACTGGAGGAGGAGGG - Intronic
933589633 2:84217813-84217835 TCAGATTCAATAAAGCAGGAAGG + Intergenic
935081260 2:99797466-99797488 TTGGAGTCCCTACAGGAGAAAGG + Intronic
936406524 2:112209683-112209705 TTGAAGTCACAAAAGGAAGATGG + Intergenic
938167345 2:129042587-129042609 TCAGAGTCACCAAAGGTGAAAGG - Intergenic
941015702 2:160353710-160353732 TTGGAGTCACAAAACTAGGAAGG - Intronic
943811443 2:192194379-192194401 TGGCAGTCACTTAAGGAGGTAGG + Exonic
944253998 2:197605924-197605946 GAGGAATCAATAAAGGAGGAGGG - Intronic
945276914 2:207997357-207997379 TTGGACTTACTACAGGAGGAAGG + Intronic
946283644 2:218685368-218685390 TCTGTGTTACTAAAGGAGGTTGG - Intronic
947757412 2:232577348-232577370 TGGGAGTCATCCAAGGAGGAAGG - Intronic
948660054 2:239501533-239501555 TCAGAGCCATTCAAGGAGGATGG - Intergenic
1169625893 20:7568614-7568636 ACGAAGTCAGTAAAGGAGCAAGG + Intergenic
1172299032 20:33835429-33835451 CTGGAGTCCCCAAAGGAGGAGGG - Intronic
953753416 3:45627037-45627059 TCGGGGACACCAAAGGAGGTGGG - Intronic
954413638 3:50382240-50382262 TGGGGGTCCCTGAAGGAGGAAGG - Intronic
954804263 3:53206841-53206863 TTGGAATCACTGAAGGAGGAAGG + Intergenic
961334366 3:126161449-126161471 CAGGAGTCACAAAAGGAGCAAGG + Intronic
964656106 3:159067521-159067543 TTGGAGTCTTTCAAGGAGGAAGG - Intronic
966302048 3:178490027-178490049 ACATAGTTACTAAAGGAGGAAGG - Intronic
972238967 4:37168074-37168096 TCTGAGTTCCTAAAGGAAGAGGG + Intergenic
973598479 4:52516673-52516695 TCAGAGCAACTGAAGGAGGAAGG + Intergenic
973936077 4:55848214-55848236 AGGGAGTCACTAAATAAGGATGG - Intergenic
973963921 4:56141032-56141054 TAGGAGTCAGTGAAAGAGGAGGG + Intergenic
981641224 4:146945801-146945823 TCGGAATCACTGAGAGAGGAGGG - Exonic
982379244 4:154732100-154732122 TCTGAGACAGGAAAGGAGGAAGG - Intronic
982419592 4:155178861-155178883 TGGGAGTTCCAAAAGGAGGAAGG - Intergenic
984714732 4:182915897-182915919 GCGGAGTCAGCACAGGAGGAGGG + Intronic
989444418 5:41510698-41510720 GCGGAGGCACTAAGGGAGCACGG - Intergenic
989494014 5:42090398-42090420 TCTGAGTCACTGAGGAAGGATGG - Intergenic
990888826 5:60625699-60625721 TTGGAATCCCTGAAGGAGGAGGG - Intronic
991063706 5:62403983-62404005 TTGGAGTCACAGAGGGAGGAAGG + Intronic
991266466 5:64725575-64725597 TCGGAGTCACTAAAGGAGGAAGG - Intronic
995946270 5:117650311-117650333 TCAGAGTCCCTAAAGGACCAGGG - Intergenic
998201791 5:140130663-140130685 TCGGAGTCTTTAAAAGATGAAGG - Intergenic
1006175984 6:32121860-32121882 GAGGAGCCACTAAAGGAGAAAGG - Intronic
1008804984 6:55416154-55416176 TCCAAGTCACTCAAGGAAGATGG - Intergenic
1009508735 6:64520220-64520242 TGAGACTCACTAATGGAGGAGGG + Intronic
1015988894 6:138914714-138914736 TTGGAGGCACTGCAGGAGGATGG + Exonic
1016464090 6:144308715-144308737 TTTGAGTAAGTAAAGGAGGATGG - Intronic
1024021623 7:45376159-45376181 TTGGAGTCACCAAGGGACGATGG + Intergenic
1025150450 7:56542660-56542682 TCTAAGTCAACAAAGGAGGAGGG - Intergenic
1027810224 7:82887343-82887365 TGGGATTCAATAAAGGAGTAAGG - Intronic
1028693365 7:93680038-93680060 TCAGAGTCAGTAAAAGAAGAGGG - Intronic
1029458411 7:100682474-100682496 TATGAGTCACTGAAGGGGGAGGG + Exonic
1029915174 7:104201382-104201404 TGGGAATCACTAAGGGATGATGG - Intronic
1035130501 7:156648261-156648283 TTGGAGTCACACAAGGTGGAGGG + Intronic
1035652643 8:1280512-1280534 TGGGGGTCTATAAAGGAGGAGGG + Intergenic
1038317040 8:26494077-26494099 TTGGAGTCACCAAAGGAAAAAGG + Intronic
1040900117 8:52410010-52410032 TGGGAGTCAAGAAAGGGGGAGGG + Intronic
1041518186 8:58725947-58725969 TTGGTGTCACTAAAGGGTGAAGG - Intergenic
1042809707 8:72810690-72810712 TGGAAGTAACTAAAGGAGGGTGG - Intronic
1042944968 8:74145322-74145344 CCAAGGTCACTAAAGGAGGAAGG - Intergenic
1045920036 8:107518660-107518682 TCGGAGTGCCTAAATGTGGAAGG - Intergenic
1048746507 8:137620154-137620176 ACTGAGTCACTAAATGATGATGG - Intergenic
1048917217 8:139196792-139196814 TTGGAGTCTGTTAAGGAGGATGG - Intergenic
1048921082 8:139230741-139230763 TTGGGGTCACAAAAGGAGGAGGG + Intergenic
1052042045 9:23749884-23749906 TAGTAGGCACCAAAGGAGGAAGG - Intronic
1058882790 9:109300014-109300036 TCCGAGTCACAGAAGGAGGGAGG + Intronic
1186557738 X:10577785-10577807 TTTGATTGACTAAAGGAGGAAGG + Intronic
1188887649 X:35569901-35569923 TCTGAGTCTCAAAAGGATGAAGG + Intergenic
1192481128 X:71487119-71487141 TGGGAGTCCCTGAAGGAAGAGGG - Intronic
1196134126 X:112188650-112188672 TTGGAGTCACTGAAAGTGGAAGG - Intergenic
1197866386 X:131023173-131023195 TCAGAGTCATCAAAGGAGGAGGG - Intergenic
1198682147 X:139194659-139194681 TAGGTGTCGCTAAGGGAGGAGGG + Intronic
1201442125 Y:14019707-14019729 TCTTACTCACTAAGGGAGGAAGG - Intergenic