ID: 991267212

View in Genome Browser
Species Human (GRCh38)
Location 5:64734977-64734999
Sequence CTTCCATAACATAAGAAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 233}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991267212_991267215 18 Left 991267212 5:64734977-64734999 CCTTGTTTCTTATGTTATGGAAG 0: 1
1: 0
2: 0
3: 15
4: 233
Right 991267215 5:64735018-64735040 TTAAGTATGATGTAACATTTTGG 0: 1
1: 0
2: 2
3: 66
4: 701

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991267212 Original CRISPR CTTCCATAACATAAGAAACA AGG (reversed) Intronic
904600370 1:31669550-31669572 TTTCCATGACATAAGACAGATGG + Intronic
908518436 1:64917103-64917125 ATTTCATAACATTGGAAACAAGG + Intronic
909513217 1:76478282-76478304 CTGCCATAATATAATAAAGATGG - Intronic
909798426 1:79774183-79774205 TTTCCAGGTCATAAGAAACAAGG - Intergenic
910695734 1:90013402-90013424 CTTAGAAAACATAAGAAAAAAGG + Intronic
912166468 1:107047422-107047444 CTTCCATTACATGAGAACCGTGG + Intergenic
912389851 1:109295414-109295436 TTCCCACAACATAAGGAACAGGG - Intronic
912979545 1:114358242-114358264 CTTCCATAGCAAAGGAATCAGGG - Intergenic
913147295 1:116004713-116004735 CTTCCATAAAATATAAAAGAAGG - Intronic
913211144 1:116583491-116583513 GTTCCATGACATAAGAGACCTGG + Intronic
913417279 1:118623480-118623502 TTCCCCTAAGATAAGAAACAAGG - Intergenic
917226950 1:172794231-172794253 CTTCCAAAACATAGAAAAGAAGG - Intergenic
917872376 1:179253604-179253626 CTTCACTCACATAAGAAAAATGG + Intergenic
918617014 1:186556473-186556495 CTTCCAACAAACAAGAAACAAGG - Intergenic
920031004 1:203037377-203037399 CTCCCATAAGATAAGAGAGAGGG + Intronic
921225120 1:213011208-213011230 CTTCCATATCAGGAGGAACAAGG + Intronic
921491996 1:215788659-215788681 CTTTCATAGGAAAAGAAACATGG + Intronic
1063477177 10:6339525-6339547 CTTCCTCAACATATTAAACATGG + Intergenic
1064816038 10:19263789-19263811 CTTGCATAAAAGCAGAAACATGG - Intronic
1066538808 10:36421515-36421537 CTTCCATAAAAGCAGAAACTGGG - Intergenic
1067304006 10:45042110-45042132 CTTCCATAATCTAAGAATTAGGG - Intergenic
1070705704 10:78636457-78636479 GTTCCATAACCTATGAAACATGG - Intergenic
1071146627 10:82582253-82582275 ATTCCATATCATCAGAAAAATGG + Intronic
1071274243 10:84038353-84038375 CTTGTATAACATAACAATCAAGG - Intergenic
1072297099 10:94019825-94019847 TTTCCATTATATAACAAACATGG - Intronic
1072917356 10:99546585-99546607 AATCCATAACATGAGAAAAATGG - Intergenic
1073167738 10:101472466-101472488 CTTTCCTAACATAGGAAACCTGG + Intronic
1073526181 10:104184402-104184424 CTCTCATAACATAAGAAATGTGG - Intronic
1074397764 10:113112751-113112773 CCTCCATAACATCAGAGAGAAGG - Intronic
1076600698 10:131655143-131655165 CTTCCATGACCTAAGGAACGTGG - Intergenic
1077863789 11:6206336-6206358 CTTCCACAAAATAAGAAATTTGG + Intronic
1078020814 11:7654719-7654741 GTACCGCAACATAAGAAACAAGG - Intronic
1080216488 11:29847861-29847883 GTTCCTTAACATCAGGAACAAGG + Intergenic
1081265199 11:41012752-41012774 CTTCTATAAAAAAAGAGACAAGG - Intronic
1087599922 11:100300847-100300869 ATTAGATAACATAAGTAACATGG - Intronic
1089243703 11:117102745-117102767 CTGCCATCACATAGGAATCAAGG + Intergenic
1091134064 11:133171971-133171993 CTTCCATAGCATGTGAATCATGG + Intronic
1091685725 12:2560720-2560742 CTGCCATACCATCAGCAACAAGG + Intronic
1091892953 12:4076029-4076051 CTTCCCTAAGATCAAAAACAAGG - Intergenic
1093471766 12:19509790-19509812 CTTCGATAATATTAGTAACATGG + Intronic
1093665311 12:21805287-21805309 CATCCATAATAGAAGAGACACGG + Intronic
1094048107 12:26189584-26189606 CTTCCATTAAATAAAAAAAAAGG + Intronic
1094678189 12:32642540-32642562 CTACCAAAACAGAAGTAACATGG + Exonic
1095183467 12:39173700-39173722 CTTCCAGAACATAGCAACCAAGG - Intergenic
1095326422 12:40899420-40899442 TTGCCATATCATAATAAACAAGG - Intronic
1096599278 12:52717974-52717996 CTTCTACAACAGAAGAAAGAAGG + Intergenic
1096875325 12:54625651-54625673 CTTCCATAACCTCAGAAAGCAGG + Intergenic
1097006093 12:55918942-55918964 CTCCCATAAGATATTAAACAGGG + Intronic
1097146125 12:56940505-56940527 CTTCCCCAACATAACAATCAAGG - Intergenic
1097151842 12:56984982-56985004 CTTCCCCAACATAACAATCAAGG - Intergenic
1097706560 12:62874905-62874927 TTTCTATAACATGAGAACCAAGG + Intronic
1098081232 12:66787626-66787648 CTTACATGACAGAAGGAACAAGG - Intronic
1099922377 12:88975027-88975049 CACCCATAACATTAGAAAAATGG - Intergenic
1102082154 12:110107149-110107171 CTTACAAAAAACAAGAAACAAGG + Intergenic
1104272559 12:127295049-127295071 CTCCTATAACATAAGCCACAAGG + Intergenic
1104369122 12:128207199-128207221 CTTTCATAACAAAATATACAAGG + Intergenic
1105464478 13:20625052-20625074 CTTCAATAACAGAAGAGATAGGG - Intronic
1105466765 13:20650538-20650560 CTTTCTTAAGATCAGAAACAAGG + Intronic
1106262683 13:28081671-28081693 TTTCCCTAAGATCAGAAACAAGG - Intronic
1107153104 13:37134654-37134676 ATTCCATAGCATAAGTAAAAAGG + Intergenic
1107278288 13:38702947-38702969 CTTCAATAGCATATGAATCAAGG - Intronic
1108936469 13:55887694-55887716 CTTGCATAATAACAGAAACAAGG - Intergenic
1109183693 13:59245194-59245216 CTTCCATATCATAATGAATAGGG - Intergenic
1109190951 13:59323693-59323715 CATTCATAATATAAGAAAGAAGG + Intergenic
1109338542 13:61024748-61024770 TTTCCAAAAGATAAGAAAGAAGG - Intergenic
1109526019 13:63577371-63577393 ATTCCATAACAAAATAAACTTGG + Intergenic
1109535669 13:63715255-63715277 CATCCACAAAATAAGAAAAATGG - Intergenic
1109551352 13:63905115-63905137 CCTCCCTACCAAAAGAAACAAGG + Intergenic
1110028764 13:70577644-70577666 CTCCAAAAACATAAGCAACAAGG + Intergenic
1110643519 13:77854451-77854473 CCTCCCTATCATAAGAATCAAGG + Intergenic
1112161466 13:96872872-96872894 CTTCCATACCCTAAGAGATATGG + Intergenic
1115447473 14:33508139-33508161 TTGCCATAACATAGGAAACATGG - Intronic
1116308172 14:43284975-43284997 CTTCCACAACATAATTGACAGGG - Intergenic
1116659973 14:47697659-47697681 CTACCATAACCAAAGCAACATGG + Intergenic
1117092647 14:52266705-52266727 CTTCTATCAAATAAGAATCATGG + Intergenic
1117853531 14:60002656-60002678 ATTCCAAAAAATAAAAAACAGGG + Intronic
1120062089 14:79995989-79996011 CTTACCTAACAAAAGAAAGATGG + Intergenic
1121934085 14:98000712-98000734 CTTCCAGAAAGAAAGAAACAAGG + Intergenic
1124598874 15:31114741-31114763 CTTCCACAACAAAAGAAAAATGG + Intronic
1125383016 15:39107541-39107563 CTTCCATAAGAAAAGCAATATGG - Intergenic
1126308203 15:47285391-47285413 CTCCAATAAAGTAAGAAACAAGG - Intronic
1127521254 15:59745299-59745321 CTTCAATAAAATAGGAAGCAAGG + Intergenic
1133847676 16:9471148-9471170 CCTCCACAATATTAGAAACAAGG + Intergenic
1137378799 16:47978525-47978547 CTTGGATAACATAGGAAACTGGG + Intergenic
1138731015 16:59195281-59195303 CCTCCAGAGCATAAGACACATGG + Intergenic
1138855651 16:60687984-60688006 CTTCCAAAATATAATAGACATGG + Intergenic
1139107945 16:63851060-63851082 TTTCCAGCAAATAAGAAACAGGG - Intergenic
1140576957 16:76182103-76182125 CTTACAGTACATTAGAAACATGG - Intergenic
1147273023 17:39290444-39290466 ATTCCCTAACATCAGGAACAAGG - Intronic
1147955336 17:44130513-44130535 GTTCCCTAACACAAGGAACAGGG + Intergenic
1148762281 17:50012206-50012228 CATCCCTAAGATCAGAAACAAGG + Intergenic
1149270689 17:54974390-54974412 CTGCCAGAAAATAAGAAACTAGG - Intronic
1150019595 17:61598033-61598055 CTTCCATAGCATTAGACAAATGG + Intergenic
1151104282 17:71594416-71594438 CTGCCATAACAAAATAAACTGGG + Intergenic
1151156382 17:72126210-72126232 CTTCTGTAACTTAAGAAACCTGG + Exonic
1151918036 17:77133197-77133219 CTACCATAACAAAAGCAGCATGG - Intronic
1152305617 17:79518722-79518744 CTTCCCTAACAGAAGCAACACGG + Intergenic
1155834593 18:30565104-30565126 CTTCCTAAACATATGAAAGATGG + Intergenic
1156783256 18:40877937-40877959 CTTCCCTGGCATAAGAAACAGGG - Intergenic
1158250682 18:55484104-55484126 CTCTCATAACATAAGAAAATAGG - Intronic
1164313665 19:24068113-24068135 CATCCATCACCTAAGAAACGTGG + Intronic
1164585445 19:29469159-29469181 CTCCCCTAAAATGAGAAACAAGG + Intergenic
928040610 2:27872833-27872855 CACCCATCAAATAAGAAACATGG + Intronic
928418013 2:31112813-31112835 ATTCCATAACATGAGAAAGGAGG - Intronic
929237117 2:39617086-39617108 TTTCCCTATCCTAAGAAACACGG - Intergenic
930182004 2:48369681-48369703 CTTTTATAAAATTAGAAACAAGG + Intronic
931103555 2:59029909-59029931 TCTCCATAACAGAAAAAACATGG + Intergenic
932841367 2:75085785-75085807 CTTCAATAAGATATGAAAAAAGG - Intronic
933112671 2:78423675-78423697 CTCACATAGCAGAAGAAACAAGG - Intergenic
933378524 2:81513378-81513400 CTTCCATAAGATGAGAAAGAGGG + Intergenic
933431578 2:82186718-82186740 CTTCCATATCGTATGAAACTAGG - Intergenic
933630216 2:84647258-84647280 TTTCCATAACATAAGGTACAAGG + Intronic
935309797 2:101772238-101772260 CTTCCAGGAAATAAGAACCAAGG - Intronic
937691390 2:124759734-124759756 ATTTCCTAACATAAGAAACAAGG - Intronic
940075694 2:149739434-149739456 CTACCAGAACATAAGACAAAGGG - Intergenic
940143331 2:150519994-150520016 TTTACAAAACATAAAAAACATGG + Intronic
940262532 2:151796902-151796924 CTTCCATTTCATAATCAACAAGG + Intronic
941589209 2:167397875-167397897 CTGCCAGAACCTAAGAAAGAAGG + Intergenic
944214715 2:197243329-197243351 CTTAAAGAACCTAAGAAACAAGG + Intronic
944979367 2:205097258-205097280 AATCCATAACATAAGTAATAAGG + Intronic
945910864 2:215647618-215647640 CATCCATATCAAATGAAACAAGG + Intergenic
946592018 2:221260595-221260617 CATCTATAAAATAATAAACATGG + Intergenic
948129676 2:235591314-235591336 TTTACATAACTTAAAAAACAGGG - Intronic
1169797442 20:9478901-9478923 CGCCTATAACATCAGAAACATGG - Exonic
1169855816 20:10101621-10101643 CTTTAAAAACATAAGAACCAAGG + Intergenic
1169941643 20:10944228-10944250 CTTCCATAATCTCAGATACAGGG + Intergenic
1172723583 20:37018068-37018090 CTTCCAAAACACAATTAACAGGG + Intronic
1173767700 20:45628890-45628912 CTTCCCTAACAGGAGAAAGAGGG - Intronic
1174250358 20:49214887-49214909 AGTCCATAACAGAAGGAACATGG + Intergenic
1177008281 21:15700637-15700659 TTTCCATGAAATAAGAACCAAGG + Intergenic
1177398939 21:20576873-20576895 CTTCACTAACATAAAAAATAGGG - Intergenic
1177595649 21:23238684-23238706 ATGACATAACATAAGATACAAGG + Intergenic
1178625605 21:34215561-34215583 CTAACTTAAAATAAGAAACATGG - Intergenic
1181719021 22:24759667-24759689 CTTCCACAAGTTAAGACACAAGG + Intronic
1181963316 22:26638645-26638667 CTTTCATAACCTAAGAAAATTGG - Intergenic
949563498 3:5224026-5224048 CATCCATAAAATAAAAAATAAGG - Intergenic
954965999 3:54611599-54611621 TTTCCATAAAATGAGAAACATGG + Intronic
955158260 3:56439069-56439091 GTTCCAGAACATATGAAAAATGG - Intronic
955989393 3:64610211-64610233 CTTCCTTGACATCATAAACAAGG + Intronic
957538842 3:81541606-81541628 CCTCCACAGCAGAAGAAACAAGG - Intronic
958029621 3:88092129-88092151 TTTCCATACCAGAAGAAAAATGG + Intronic
960105091 3:113787081-113787103 CTAGAATAACTTAAGAAACATGG - Intronic
961203756 3:125064608-125064630 CTTCCATAACATACAAAACCAGG - Intergenic
961924802 3:130467051-130467073 CTTCCAGAACATAAAAGAAAAGG + Intronic
962581651 3:136803456-136803478 CTCCCATAACATAGGACAAAAGG - Intergenic
964326758 3:155555244-155555266 CCTCGATAAAAGAAGAAACAGGG - Intronic
964800351 3:160550269-160550291 CTTTCAAAACAAAACAAACAAGG - Intronic
964874465 3:161350413-161350435 CTTCTAGAACATCAGAATCAGGG + Intronic
964900499 3:161653326-161653348 ATACCATAATATAAGAGACAAGG + Intergenic
966369844 3:179238589-179238611 CTTCCATATCATTAAAAACAAGG - Exonic
969889956 4:10250832-10250854 CTTCTAGAACATAATACACAGGG - Intergenic
970193657 4:13536653-13536675 CTTACATCACCTAATAAACAGGG - Intergenic
973109581 4:46380384-46380406 CTTCCAAAACATGATAAACTTGG - Intronic
973828672 4:54736131-54736153 CTTCCTTAAAAACAGAAACACGG - Intronic
975599114 4:76080946-76080968 TTCACATAACATAAGAAGCAGGG - Intronic
975666352 4:76738926-76738948 CTTCCATAACAAGAGAGACTCGG + Exonic
977511865 4:97972145-97972167 TTTCCTTAACATATGGAACATGG + Intronic
978917545 4:114145437-114145459 AATCCATAATATAAGAAGCAGGG + Intergenic
980624493 4:135356713-135356735 TTTCCAAAACATAACAAACCTGG + Intergenic
981450242 4:144888651-144888673 CTTCCAGATCATAAAAAAGATGG + Intergenic
983124636 4:163935465-163935487 TTTCCATAACATAAAGAGCAAGG - Intronic
983331921 4:166340711-166340733 CTCCCATAACAGAAGACAAAAGG + Intergenic
983826829 4:172272864-172272886 CTTCTATAATGTAAGAAAGAAGG + Intronic
984115329 4:175673003-175673025 GTTACATAACATTAGAAAAAAGG + Intronic
984250408 4:177326144-177326166 CTTCCAGAAGAAAACAAACAAGG - Intronic
985319763 4:188697383-188697405 CTTGTGTAACATTAGAAACATGG - Intergenic
986442262 5:7792820-7792842 CATCCATAAAAGAAGAAGCATGG + Intronic
986719044 5:10546994-10547016 CTTCCATAAATGAAGGAACAAGG - Intergenic
987168614 5:15228059-15228081 TTTCCCTAAGATCAGAAACAAGG - Intergenic
990018359 5:51094542-51094564 CATCCAAAACATGAGAACCAAGG - Intergenic
990211595 5:53485469-53485491 CTACCAAAACACAAGAAATAGGG - Intronic
991267212 5:64734977-64734999 CTTCCATAACATAAGAAACAAGG - Intronic
991403681 5:66280089-66280111 CTTCCTTAAAATATGAATCAGGG + Intergenic
992146658 5:73857043-73857065 ACTCCATAAAATAAGAAGCAAGG - Intronic
993802535 5:92360549-92360571 CTTCTTAAACATATGAAACATGG + Intergenic
993915256 5:93736775-93736797 ATTCAATAACCTAAGAAAAAAGG + Intronic
994533843 5:101002098-101002120 CTCAAAGAACATAAGAAACAAGG + Intergenic
994681766 5:102896680-102896702 CTTCCACAGCCTAAGAAATATGG + Intronic
994896656 5:105713480-105713502 CTTCCATAAATGAAGTAACAAGG + Intergenic
994968169 5:106700299-106700321 CTTCAATAACATAACAATCTAGG - Intergenic
995408695 5:111830960-111830982 CTTCCATCACTTATGGAACAGGG - Intronic
996166558 5:120230266-120230288 TCTCCATAAGATCAGAAACAAGG - Intergenic
999410604 5:151346706-151346728 CTTCCAAAACATAAAAAAAGAGG - Intronic
1007309434 6:40933774-40933796 CATCCATAAAATAGGGAACACGG + Intergenic
1008418392 6:51269548-51269570 CTTTCAGATCATAAGAAAAAAGG + Intergenic
1009660766 6:66607479-66607501 CATCCATCACAGAAGAAAGATGG + Intergenic
1009982628 6:70743622-70743644 CTTCCACAAAATAAGAAAAAAGG - Intronic
1011855182 6:91681229-91681251 ATTTCATAAAATAAGAAATATGG + Intergenic
1012562467 6:100600128-100600150 TTTCTATTACATAAGAATCAAGG - Intronic
1014321539 6:119935314-119935336 CTTTCTTAACATAAAAAAAATGG - Intergenic
1014512279 6:122338317-122338339 CTTACATAACATGAGGAACAGGG + Intergenic
1015368753 6:132426498-132426520 CTTCCCTAATTTCAGAAACAAGG - Intergenic
1016786570 6:148016969-148016991 ATACCAAAACATAAGACACATGG + Intergenic
1018966236 6:168491352-168491374 TTTCCATAACATCCGAATCATGG + Intronic
1021022169 7:15615220-15615242 CATCTATAACATAAGAATAATGG - Intronic
1022159134 7:27691523-27691545 CCTCCCTAACAGAAGAAAGAAGG + Intergenic
1022865648 7:34416505-34416527 CTTCCATAAAATAAAAACAAAGG - Intergenic
1024408317 7:49008316-49008338 CTTTTAGAACCTAAGAAACAAGG - Intergenic
1024467867 7:49731906-49731928 CTTCCATAACAGCAGAAGCCTGG + Intergenic
1024624228 7:51190582-51190604 CTTCCACGACATAAGTAAAAGGG - Intronic
1024714863 7:52067172-52067194 CTTCCAGAGAATAAGAAACCTGG + Intergenic
1024869438 7:53945232-53945254 CTTCTCTAAGATAAGGAACAAGG - Intergenic
1027375076 7:77539995-77540017 CTTCCATAACCAAAGTAAGACGG - Intronic
1028809062 7:95062841-95062863 CTTTCATAATAGAAGAAACATGG - Intronic
1029026506 7:97422397-97422419 ATTAAATAACATAAGAAATATGG - Intergenic
1030277931 7:107739919-107739941 CTTCCAGTATATAAGCAACAGGG - Intergenic
1032744024 7:134767805-134767827 CTTTCATATAATCAGAAACACGG - Intronic
1033612390 7:142976378-142976400 CCCCCATAAGATCAGAAACAAGG + Intergenic
1034209137 7:149347506-149347528 TTTCTGTAAGATAAGAAACAAGG + Intergenic
1035400360 7:158561064-158561086 CTTCACTAAAATTAGAAACAGGG - Intronic
1035839080 8:2791051-2791073 CTTCCTTAGCCAAAGAAACATGG - Intergenic
1036064890 8:5368764-5368786 CTTGCAGAACATCAGAAACTAGG - Intergenic
1037126513 8:15357980-15358002 CTTGCATAAGAAAAGTAACAGGG + Intergenic
1037429913 8:18800177-18800199 CTTGGATAAAATAAGAAATATGG - Intronic
1037925449 8:22840540-22840562 ATTCCCTAACAAAAGAACCAAGG - Intronic
1040341609 8:46443898-46443920 CTTCCATTTCAGAAGAACCAAGG - Intergenic
1041622010 8:59982347-59982369 TCTCCATAACATAAAATACAAGG - Intergenic
1042584993 8:70326540-70326562 CTTTCATAAAATATAAAACAAGG + Intronic
1042746758 8:72116772-72116794 CTCCCATAAGATCAGGAACATGG - Intronic
1043117809 8:76281744-76281766 ATTCCATATCATAAAAAAAATGG - Intergenic
1044293228 8:90497317-90497339 CTTCCATTTCATAATCAACAAGG - Intergenic
1045001396 8:97881253-97881275 CATCCATAAAATAAGAGGCATGG - Intronic
1045771012 8:105740619-105740641 CTTACAGACCATAAGAAATACGG + Intronic
1045813693 8:106254662-106254684 CTTCCACAACACGAGAATCATGG + Intergenic
1046360104 8:113141745-113141767 TTTCTATAACATCAGGAACAAGG + Intronic
1046825244 8:118683007-118683029 CTTCCAAAACAGAAAAAAAAAGG - Intergenic
1047878185 8:129163887-129163909 TTGCAATTACATAAGAAACATGG - Intergenic
1051253825 9:15191341-15191363 CTTCAATAACATGAGAAATTGGG + Intronic
1052226426 9:26094149-26094171 CTTCCAAAACATAGAAAAGAAGG - Intergenic
1052486440 9:29106442-29106464 CTCCCATAGCATAAGGCACATGG + Intergenic
1054840197 9:69730357-69730379 TTTCCATAAAATCAGGAACAAGG - Intronic
1055172902 9:73282521-73282543 CTTCCATTAATTAACAAACATGG - Intergenic
1056181685 9:84089698-84089720 TTTCCATAACATAAAAGTCAAGG - Intergenic
1056430764 9:86525941-86525963 CTTCCAGAACATAATAGAAAAGG - Intergenic
1188256053 X:27962903-27962925 CTTCCATATCAAAAGCTACATGG - Intergenic
1189492804 X:41483009-41483031 CTGCCATCACGTAAGAAAGACGG - Intergenic
1189686203 X:43565840-43565862 ATACCATAAGAAAAGAAACAAGG + Intergenic
1193518085 X:82494879-82494901 CTTCCTTAACATATAAATCATGG + Intergenic
1194138752 X:90181058-90181080 TTTCCTTAACACAAGCAACAGGG + Intergenic
1194182234 X:90726542-90726564 CTTCCAAAAAATAAAGAACAGGG + Intergenic
1196142368 X:112277817-112277839 CTTGAATATCATAAGGAACATGG + Intergenic
1196322933 X:114364401-114364423 CTTGGAAAACATGAGAAACAAGG + Intergenic
1197317738 X:124988980-124989002 TTTCCCTAACATCAGAAACAAGG + Intergenic
1198454225 X:136799649-136799671 ATTCCATAACATCAGATAAATGG + Intergenic
1198652762 X:138881446-138881468 CTTCCATAACATAGAAGAGAAGG - Intronic
1199118483 X:144021382-144021404 CTTTCATAACATAAAAAAGGTGG - Intergenic
1200484553 Y:3751293-3751315 TTTCCTTAACACAAGCAACAGGG + Intergenic
1201675107 Y:16572778-16572800 CTTTCAAAACTCAAGAAACAGGG - Intergenic
1201888147 Y:18909741-18909763 GTACCATAACAGAAGCAACATGG - Intergenic