ID: 991268587

View in Genome Browser
Species Human (GRCh38)
Location 5:64751582-64751604
Sequence CAGGACTGTCCTACCATTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 97}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991268584_991268587 -3 Left 991268584 5:64751562-64751584 CCAGAATGTTCTTCACTGTCCAG 0: 1
1: 0
2: 4
3: 11
4: 164
Right 991268587 5:64751582-64751604 CAGGACTGTCCTACCATTGTAGG 0: 1
1: 0
2: 1
3: 6
4: 97
991268583_991268587 13 Left 991268583 5:64751546-64751568 CCATTGGCATTTGGGGCCAGAAT 0: 1
1: 0
2: 3
3: 26
4: 151
Right 991268587 5:64751582-64751604 CAGGACTGTCCTACCATTGTAGG 0: 1
1: 0
2: 1
3: 6
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991268587 Original CRISPR CAGGACTGTCCTACCATTGT AGG Intronic
912443789 1:109717879-109717901 CAGGACTGTGCTCGAATTGTGGG + Exonic
913090278 1:115472076-115472098 CAGGACTGCCCAACCATGGCAGG - Intergenic
914378796 1:147097895-147097917 GAGGACTGTCCTATCATTGGAGG - Intergenic
915545948 1:156597919-156597941 CAGAACTTTCCTAACATAGTGGG - Intronic
916546371 1:165808849-165808871 CAGGCCTGTGCCACCATGGTTGG - Intronic
919344316 1:196355278-196355300 CAGAACTGCCCCAACATTGTAGG + Intronic
1064816810 10:19274722-19274744 CAGGAAAGTACAACCATTGTAGG + Intronic
1074284078 10:112081369-112081391 CAGAAATATCCTGCCATTGTCGG + Intergenic
1075765349 10:124888374-124888396 CAGGCCTGCCCCACCATTGCAGG + Intergenic
1076291878 10:129351768-129351790 CAGGACTGTGCTCCCACTGGAGG - Intergenic
1078457178 11:11484448-11484470 CAGGAGTGTGCTACCATACTTGG - Intronic
1079394754 11:20051919-20051941 AAGGACTGTCCTTCCATTCCTGG + Intronic
1079464637 11:20717670-20717692 AAGGACTGTCTTACCTTTGAGGG + Intronic
1081957793 11:47108672-47108694 CTGAACTGTCCCACCCTTGTGGG - Intronic
1084839988 11:71838698-71838720 CAGGACTAACCTGCCATTGCTGG - Intergenic
1086181792 11:83960831-83960853 CACCACTCTCTTACCATTGTTGG - Intronic
1088776071 11:113084478-113084500 CAGGATTGTCTTATCATTGATGG + Intronic
1089048831 11:115528251-115528273 GAGAACTGTCCTACCATTGGTGG - Intergenic
1090227427 11:125080146-125080168 GGGGACTGTCCTACCACTGCAGG + Intronic
1091352765 11:134910679-134910701 CAGGAGTTTCCTACCATCTTTGG - Intergenic
1092492152 12:8955530-8955552 CAGGAGTGTGCTACCATGCTAGG + Intronic
1094385906 12:29893433-29893455 CAGGCCTGTGCTACCATGCTAGG + Intergenic
1103558231 12:121778704-121778726 CAGTCCTGTCCTACCACAGTGGG + Exonic
1107039080 13:35930329-35930351 CAGGACTTTCCTTTCAGTGTGGG - Intronic
1107976850 13:45696805-45696827 CAGGACTCTCTTGCCATGGTGGG - Intergenic
1108647229 13:52442206-52442228 CAGGAGTGAGCCACCATTGTAGG - Intronic
1109756032 13:66761349-66761371 CAGGAATGTCCAACTATTGGGGG - Intronic
1113460859 13:110480887-110480909 CAGTTCTGTCCTTCCATTGCTGG + Intronic
1113460870 13:110480977-110480999 CAGTTCTGTCCTTCCATTGCTGG + Intronic
1113460932 13:110481487-110481509 CAGTTCTGTCCTTCCATTGCTGG + Intronic
1113460953 13:110481667-110481689 CAGTTCTGTCCTTCCATTGCTGG + Intronic
1120797516 14:88650782-88650804 CAGGCATGTACTACCATTCTTGG + Intronic
1121532525 14:94666566-94666588 TAGGTCTGTCCTAACATTTTGGG - Intergenic
1125130465 15:36278764-36278786 CAGAACTGCCCTACCTTTGCTGG - Intergenic
1128756603 15:70187609-70187631 CAGGGCTGTCCTGCCGGTGTGGG + Intergenic
1131407352 15:92176333-92176355 CAGGCCAGGCCTGCCATTGTGGG - Intergenic
1137036320 16:35572963-35572985 CAGGACTGTGCCACCATGATGGG + Intergenic
1152988043 18:337310-337332 CAGGACCTTCCTACCTCTGTAGG + Intronic
1159831809 18:73286168-73286190 CAGGCCTCACCTATCATTGTGGG + Intergenic
1161788877 19:6346638-6346660 CAGGATTATCCTAGCATTTTGGG - Intergenic
1161880521 19:6947935-6947957 ACGCACTGCCCTACCATTGTCGG - Intergenic
926014715 2:9439837-9439859 CAGGAGTGTGCTACCATACTTGG - Intronic
926120992 2:10241098-10241120 CAGGACTGTCCTTCCCCTGCAGG + Intergenic
931252107 2:60541421-60541443 CAGAAGTGTCCTACAATTGTTGG - Intronic
931827435 2:66016311-66016333 CAGGACTGTCTTCACATTGCAGG - Intergenic
941020271 2:160400457-160400479 CAAGACTGTCCTACCTATGTTGG - Intronic
948071841 2:235134172-235134194 CAGCACTGTCCTAGCAGTGTGGG + Intergenic
1169445476 20:5667698-5667720 AGGGACTTGCCTACCATTGTTGG + Intergenic
1171879073 20:30603339-30603361 CAGGCATGTGCTACCATTCTTGG - Intergenic
1175824348 20:61928536-61928558 CAGGACTGTCCCACCAAGGCTGG + Intronic
1180741417 22:18055639-18055661 CAGGCCTGCCCTAACCTTGTGGG + Intergenic
949376882 3:3400655-3400677 CACCACTGTCCTGCCCTTGTGGG - Intergenic
956221607 3:66909917-66909939 CTGGAGTGTCCTTCCATGGTGGG - Intergenic
965684697 3:171289757-171289779 CAGGACTGTGCCACCATTCCTGG - Intronic
969567273 4:7985920-7985942 CAGGACTGCCCGACCCCTGTGGG - Intronic
970134875 4:12911687-12911709 CAGGACTGTGTTGCCATTGCAGG - Intergenic
973098285 4:46229046-46229068 CAGAACAGTTGTACCATTGTAGG + Intergenic
975048311 4:69829770-69829792 AAGAACTGTGCAACCATTGTAGG - Intronic
975314661 4:72937865-72937887 GAGGACTGTACCACCACTGTAGG - Intergenic
978363999 4:107961336-107961358 TAGGATTGTCTTGCCATTGTGGG - Intergenic
980345050 4:131603393-131603415 CAGCACTGTCCTACATTTATTGG + Intergenic
980671006 4:136008066-136008088 CAGGACTGTCCTGGAATTGATGG + Intergenic
981005046 4:139866018-139866040 CAGGAATGTCCCACAAATGTAGG + Intronic
982248193 4:153376802-153376824 CTGGACTATGCTACAATTGTTGG + Intronic
983879479 4:172916927-172916949 CAGGATTGTCTTAGCAATGTGGG - Intronic
983935351 4:173499205-173499227 CTGGACTGTCCTCCCACTGAGGG + Intergenic
984975148 4:185223566-185223588 CAGGATGGTCCTACCCTTCTCGG - Intronic
988683720 5:33507466-33507488 CAGGGGTGTGCTACCATTCTTGG + Intergenic
990406587 5:55497386-55497408 CAGGCCTGTGCTACCATTCCTGG + Intronic
991154138 5:63410479-63410501 CCAGACTGTCTTACCATTGAAGG - Intergenic
991268587 5:64751582-64751604 CAGGACTGTCCTACCATTGTAGG + Intronic
998637913 5:143976956-143976978 CAGGGTTTTCCTACCTTTGTGGG - Intergenic
1006115952 6:31776350-31776372 CGGGACTGTCCCTCCTTTGTGGG - Intronic
1011739461 6:90345602-90345624 CAGGTCAGAGCTACCATTGTGGG - Intergenic
1011808686 6:91103452-91103474 CAGGAGTGTGCTACCATTCCGGG + Intergenic
1013611475 6:111799940-111799962 CAGGACTGCCCTACCTGGGTGGG - Intronic
1015320076 6:131862859-131862881 GAGGACTGGTCTACCTTTGTAGG - Intronic
1017135456 6:151143534-151143556 CAGGAGTGTCCTACCCGTGCAGG + Intergenic
1020070329 7:5223190-5223212 CAGGACTGTCCCTCCCTCGTCGG + Intronic
1021157619 7:17231242-17231264 CAGGTCTGTCCTACTTTTATTGG + Intergenic
1022637193 7:32147659-32147681 CTGGACTCTCCTTCCATTTTAGG + Intronic
1023866292 7:44239931-44239953 CAGGACAGTCCTATTAGTGTTGG + Intronic
1024929242 7:54652623-54652645 CAGGACTGGCTTTCCTTTGTTGG - Intergenic
1028888460 7:95960476-95960498 CAGGGATGACCTACCAGTGTAGG + Intronic
1029377800 7:100191125-100191147 CGGGGCTGTCCTGCCATGGTAGG + Intronic
1031082518 7:117272314-117272336 CAGGGCTGTCCTAACATTGTAGG - Intergenic
1033376722 7:140768634-140768656 CAGGAGTGTGCTACCATGCTTGG + Intronic
1034274939 7:149819900-149819922 CAGTCCTGTCCTACCCTTATTGG + Intergenic
1036456180 8:8910347-8910369 CAGGCATGTGCTACCATTCTTGG + Intergenic
1037076745 8:14729940-14729962 GAGGACTGTCCTACCATGCCCGG - Intronic
1037634545 8:20689929-20689951 CAGGACTGTCCCATCACTGTCGG + Intergenic
1046545050 8:115639204-115639226 CAGGCATGTACTACCATTCTGGG + Intronic
1046773378 8:118138475-118138497 CAGGAGTGTCCTCACATGGTGGG - Intergenic
1047302660 8:123627377-123627399 CCTGACTGTCCTACTAATGTTGG - Intergenic
1051240997 9:15055640-15055662 CAGGGCTGTTTTACCATTTTGGG - Intergenic
1051284206 9:15478495-15478517 CAGGGCTGTTTTACCATTTTGGG + Exonic
1052815141 9:33096896-33096918 CAGGCCTGAGCTACCATTGCTGG + Intergenic
1058372815 9:104289452-104289474 CAGGAAGGTCCTAGGATTGTAGG + Intergenic
1059344139 9:113616802-113616824 GATGCCTGGCCTACCATTGTGGG + Intergenic
1061717713 9:132531393-132531415 CAGGGCTGTCCTAGGATGGTTGG + Intronic
1062670422 9:137705717-137705739 CAGGGCTGTCCTCCCAGGGTAGG + Intronic
1186155735 X:6724546-6724568 CAGGATTTTCCTACTTTTGTTGG - Intergenic
1187464207 X:19514488-19514510 CAGGACCGTCCTGCCTTTGGGGG - Intronic
1196867973 X:120086596-120086618 AAGAACTGTGCTACTATTGTAGG - Intergenic
1196875130 X:120149685-120149707 AAGAACTGTGCTACTATTGTAGG + Intergenic