ID: 991271168

View in Genome Browser
Species Human (GRCh38)
Location 5:64783246-64783268
Sequence GGTGGTTTTCTCACCATGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 100}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991271168_991271172 12 Left 991271168 5:64783246-64783268 CCTGTCATGGTGAGAAAACCACC 0: 1
1: 0
2: 0
3: 3
4: 100
Right 991271172 5:64783281-64783303 GTTCCTGCTCTTTTGAAAACTGG 0: 1
1: 0
2: 1
3: 20
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991271168 Original CRISPR GGTGGTTTTCTCACCATGAC AGG (reversed) Intronic
901777645 1:11571211-11571233 TGGGGTTTTCTCACCAGGATTGG + Intergenic
907713961 1:56910656-56910678 AGTGGTTTTCTCCCCTTGGCTGG + Intronic
907876659 1:58495525-58495547 TGTGGTTTTCTAACAATGGCAGG + Intronic
909251191 1:73358763-73358785 GGGCATTTTCTCACAATGACTGG + Intergenic
911422867 1:97666707-97666729 GGTTGGTTTCTCACCATGGGGGG + Intronic
912538074 1:110390814-110390836 GTTGGTTTTCTAACAACGACTGG - Intronic
916534071 1:165686571-165686593 TGAGGTTTTCTCACCATGGCTGG - Intronic
917477437 1:175380863-175380885 CGAGGTTTTCTCACAATGAATGG - Intronic
920207823 1:204305963-204305985 GGTGGTTTTCTCACCTATTCTGG + Intronic
923044180 1:230343255-230343277 GGTGGTTCTTTCAAAATGACAGG + Intronic
1068638651 10:59376458-59376480 GGTGATTTTTCCACCAAGACAGG - Intergenic
1071819984 10:89270226-89270248 GGTGGATTTCTGGCCCTGACTGG - Intronic
1072531909 10:96327566-96327588 GATGCTTTCGTCACCATGACAGG + Exonic
1073949055 10:108785518-108785540 GCTGATTTTCTGACCCTGACAGG + Intergenic
1074856440 10:117477508-117477530 GCTGGGTTTTTCACCATAACTGG - Intergenic
1075870828 10:125771938-125771960 GGTGGTTTTCTCAACACAAGCGG - Intronic
1084478484 11:69402341-69402363 GGTGAATTTATCACCTTGACTGG + Intergenic
1087148534 11:94836624-94836646 GGGGTTTCTCTCAACATGACTGG - Intronic
1090535924 11:127641604-127641626 GGTGATTTTCTCACAATTCCAGG + Intergenic
1091317494 11:134624754-134624776 GGTGGACTGCACACCATGACTGG - Intergenic
1093184811 12:16007669-16007691 GGGGGTTGTCTCCCCATGAAGGG + Intronic
1096145725 12:49277381-49277403 GGAGGTTTTCTGACAATCACTGG - Intergenic
1100255148 12:92875822-92875844 GGTTGCTTTTTCAACATGACAGG + Intronic
1101911957 12:108866693-108866715 GGTGGTTTGCTGACCATCTCGGG - Intronic
1104676816 12:130716772-130716794 GGTGCTTTTCTCTCCATCCCTGG + Intergenic
1105876075 13:24554582-24554604 GGTGGGTTTCTCCCCATGTGTGG + Intergenic
1110505116 13:76277036-76277058 GGTAGTGTTTTCACCGTGACAGG + Intergenic
1111353426 13:87063947-87063969 GGTGGTTTTGTCACCCAGGCTGG + Intergenic
1112154194 13:96799358-96799380 GGTTGGTTCCTCACCATCACTGG - Intronic
1113417154 13:110137232-110137254 GGTGGTTTTCTCAGCTTTGCTGG - Intergenic
1116858268 14:49972998-49973020 GGAGGTGTTCTCATCATGAATGG + Intergenic
1117789340 14:59322870-59322892 GGTGCATTTCTCTTCATGACAGG + Exonic
1127018103 15:54711501-54711523 GGTGGTATTATCTCCATGTCAGG - Intergenic
1128965297 15:72052062-72052084 GGTGGTTGTCTCCCCAAGTCTGG - Intronic
1131404202 15:92150492-92150514 GGTGGATTTCACAAAATGACTGG + Intronic
1132961114 16:2623338-2623360 GGAGGTTCTCTCAGCATGGCCGG - Intergenic
1133881478 16:9786600-9786622 GGTGGTTTTCTCATCTGGAAAGG - Intronic
1142803688 17:2360723-2360745 GGTGGTTTTTTCACACGGACTGG - Intronic
1147674046 17:42192806-42192828 GGTTCTTTGCCCACCATGACTGG + Intronic
1150861514 17:68805747-68805769 GGTGGTTTGCTGACCATCTCTGG - Intergenic
1156473071 18:37389562-37389584 TGTGGTCTGCTCACCATGGCTGG + Intronic
1156544851 18:37954382-37954404 AGTGGTTCTCTCACTTTGACTGG + Intergenic
1158943333 18:62426351-62426373 GATGATTTTGACACCATGACGGG + Intergenic
1159863406 18:73675603-73675625 CGTGTTTTTCCCACCATGTCTGG + Intergenic
1160996493 19:1884579-1884601 GGCGGGTTTCCCACCCTGACTGG - Intronic
1161139076 19:2637303-2637325 GCTGGTTTTGTCATCAGGACAGG + Intronic
1161196050 19:2987364-2987386 GGTTGTTTACTCACCAGGCCTGG - Exonic
925016109 2:525574-525596 GCTGCTTTTCTCATCGTGACTGG - Intergenic
926421468 2:12703972-12703994 GATGGTTTTATTACCATGCCTGG + Intergenic
929601862 2:43209610-43209632 GGTGGTGTTCTAACCATCATGGG - Intergenic
935672635 2:105569057-105569079 GGTGGATTTGTCACGATAACTGG - Intergenic
937062736 2:118992410-118992432 GTGGGTTTTCTCCTCATGACAGG + Exonic
939058032 2:137386115-137386137 GGTGGTTGTAACACCATGAAAGG - Intronic
939304597 2:140394548-140394570 GGTAGTTTTCTCAACATGGAAGG - Intronic
946484187 2:220085068-220085090 ACTGGTTTTCTCACCATTGCTGG + Intergenic
948507640 2:238440589-238440611 GGTGGCCTTCTCACCTTGTCAGG + Intronic
1169413207 20:5392394-5392416 GGTGGTTTTGTAACTATCACTGG - Intergenic
1172446481 20:34996106-34996128 TGTGGATTTCTCACCAGGCCAGG + Intronic
1179001206 21:37460476-37460498 GGTGGTTCTCTAACTTTGACTGG - Intronic
1183219038 22:36500220-36500242 GGTGATTTTCTCACCATTATGGG - Intronic
1183612610 22:38920615-38920637 CATGTTTTTCTCACCATCACTGG + Intergenic
1183712955 22:39516935-39516957 GTGGGTTTGCTGACCATGACTGG + Exonic
950116988 3:10457339-10457361 GGTGGTTTTCTTAGTATGAGTGG + Intronic
950297841 3:11847314-11847336 GGTGGTATTCTCTACATGGCGGG - Intergenic
958035042 3:88160268-88160290 GTTGGTTTTGTCTCCATGTCTGG - Intronic
958817028 3:98927918-98927940 GATGGATTTCGCACCTTGACAGG - Intergenic
965085547 3:164091116-164091138 GATGGTTTTGTCACCAAGATAGG - Intergenic
966999995 3:185325289-185325311 GGGGGTTCTCTCACAAGGACAGG + Intronic
968986321 4:3876625-3876647 CGTGCTTTTGTCACCCTGACGGG - Intergenic
971542467 4:27837085-27837107 GGTGGTATTCTAATCATGAAAGG - Intergenic
978702368 4:111663267-111663289 GGTAATTTTATGACCATGACTGG - Intergenic
980651263 4:135718102-135718124 GGTGGTTTGCTCTCCTTTACCGG - Intergenic
985690518 5:1309042-1309064 GGTGGTTTTCTTCCCATTGCAGG + Intergenic
989998226 5:50861016-50861038 GGTGTTGTCCTCACCATTACTGG + Intergenic
991271168 5:64783246-64783268 GGTGGTTTTCTCACCATGACAGG - Intronic
993757799 5:91752524-91752546 GATGTTTTTCTCTCCATGCCTGG + Intergenic
997803182 5:136887723-136887745 TCTGGTTTTCTCACCAAAACAGG - Intergenic
1006887623 6:37395673-37395695 GGTGGCTTTCTCACAAGAACAGG - Intergenic
1011259129 6:85453579-85453601 GGTGAGATTCTCACCAAGACAGG + Intronic
1015656111 6:135521072-135521094 GGGGGTTCTATCATCATGACAGG - Intergenic
1030200214 7:106895476-106895498 GGTGGTTCTCTCACCCTGGGGGG - Intronic
1031363804 7:120879365-120879387 TGTGGTTTTCTAATTATGACAGG - Intergenic
1034316221 7:150135994-150136016 GGTGATTTCTTCATCATGACAGG - Intergenic
1034790638 7:153964667-153964689 GGTGATTTCTTCATCATGACAGG + Intronic
1035372937 7:158390977-158390999 GGTGGGTTTCACACCATTTCAGG - Intronic
1045079760 8:98612843-98612865 TGTTCTTTTCTCACCATGTCAGG - Intronic
1047945480 8:129873847-129873869 GGTGTTTTTCTCACCCTAAAGGG - Intronic
1048842277 8:138576640-138576662 TGTGTTTTTCTCACCTTGACTGG - Intergenic
1051417523 9:16858119-16858141 GGTGTTTTTCTAGTCATGACGGG + Intronic
1055939907 9:81639415-81639437 GATGTTTTTTTCAACATGACAGG + Intronic
1056053903 9:82800576-82800598 GGTCTTTTTCCCTCCATGACTGG + Intergenic
1060941247 9:127544235-127544257 GGTGGGTTTCTCACAGAGACGGG + Intronic
1061198272 9:129120655-129120677 AGTGGTTTTCCTAGCATGACGGG + Intronic
1062571350 9:137186944-137186966 GGTGGTTTTGTCACATTGAACGG - Intronic
1188312614 X:28636303-28636325 GGTGGTTTGCTCACTCTGCCTGG - Intronic
1189081538 X:37978092-37978114 GGTTATTTTCTCACTATTACTGG - Intronic
1189728760 X:43996890-43996912 GGTAATTTTCTCACCAAAACAGG - Intergenic
1192561139 X:72128851-72128873 GGTGGTCTTCTCCCCTTGCCAGG - Exonic
1196239683 X:113328110-113328132 TGCTGTTTTCTCACCATGATAGG + Intergenic
1197543565 X:127795686-127795708 TGTGTTTTTCTTTCCATGACTGG - Intergenic
1198344645 X:135747601-135747623 GGTGGGTTTCTCCCCATGTGTGG + Intergenic
1199550549 X:149056899-149056921 GGTGGGTTCCTCACCTTGATAGG - Intergenic
1199617778 X:149671513-149671535 GGTGGGTTCCTCACCTTGATAGG + Intergenic
1199624864 X:149731736-149731758 GGTGGGTTCCTCACCTTGATAGG - Intergenic