ID: 991271613

View in Genome Browser
Species Human (GRCh38)
Location 5:64790047-64790069
Sequence TTTAATTACATTTTAATGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 680
Summary {0: 1, 1: 0, 2: 2, 3: 55, 4: 622}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991271613_991271615 2 Left 991271613 5:64790047-64790069 CCTTGCATTAAAATGTAATTAAA 0: 1
1: 0
2: 2
3: 55
4: 622
Right 991271615 5:64790072-64790094 GGTGTGTATATGAAATATTTTGG 0: 1
1: 0
2: 4
3: 22
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991271613 Original CRISPR TTTAATTACATTTTAATGCA AGG (reversed) Intronic
901106858 1:6763123-6763145 CTTAATTGCATTCTAATGAAAGG + Intergenic
901750977 1:11408264-11408286 TTAAAATGCTTTTTAATGCATGG - Intergenic
903631043 1:24771379-24771401 TTTAATTACATTTTTGTTCCAGG + Intronic
904439478 1:30521142-30521164 ATTAATTTCATTTTAATTGAAGG - Intergenic
904731972 1:32599969-32599991 GTTAATTTGAGTTTAATGCATGG + Intronic
904939266 1:34153652-34153674 TTAAAGTACAATTTAATGGATGG - Intronic
905163651 1:36061732-36061754 TTTAATCATTTTTTAAAGCAAGG + Exonic
905343633 1:37296479-37296501 TCTTATTACATTTTGATGGATGG - Intergenic
906179167 1:43803593-43803615 TGTATTCACACTTTAATGCATGG + Intronic
907285076 1:53374846-53374868 TTTCCTTACATTTTACAGCATGG + Intergenic
907738963 1:57144808-57144830 TATAATTACATTTTACTTTAAGG + Intronic
907749680 1:57250558-57250580 TTTAAATACATTTTATTGGAAGG - Intronic
907852363 1:58267804-58267826 TCTAAATAGATATTAATGCATGG - Intronic
908141941 1:61194183-61194205 TTTTATGACATCTTAATGGATGG - Intronic
908320734 1:62975749-62975771 TTAAATTAAATTTTAAAACAAGG - Intergenic
908320830 1:62977212-62977234 TCTGACTGCATTTTAATGCATGG - Intergenic
908730170 1:67218131-67218153 TTTCATTACGTTTTATAGCAGGG + Intronic
908832916 1:68198848-68198870 TTCACTTACATTTTTATTCAAGG - Intronic
908882374 1:68746448-68746470 TTTAATTAACCTTTAATACAGGG - Intergenic
909529508 1:76666576-76666598 TTGAAATATATATTAATGCAAGG + Intergenic
909766096 1:79357891-79357913 TTTAATTACAACATATTGCATGG + Intergenic
909829314 1:80166001-80166023 TTTATTTACATATTTATTCACGG - Intergenic
910523454 1:88150297-88150319 TTTAATTACATTTGAAAGCAAGG - Intergenic
911732328 1:101304157-101304179 TTTAATTACATGCAAATGAAGGG - Intergenic
911792584 1:102036913-102036935 TTGAATAACATTCTAATGTATGG + Intergenic
911858158 1:102908840-102908862 TTTAAATACATTTTAATCAGGGG + Intronic
911994122 1:104741344-104741366 TGTAATAACATTTTAATTCTGGG - Intergenic
911995610 1:104762004-104762026 TTTAATAACTCTTCAATGCAAGG + Intergenic
912170753 1:107096579-107096601 CTTAATTAAATTTTAAAACATGG + Intergenic
913593454 1:120351394-120351416 TATAATTACTTTTTAAGACAAGG - Intergenic
914093801 1:144527592-144527614 TATAATTACTTTTTAAGACAAGG + Intergenic
914304724 1:146406312-146406334 TATAATTACTTTTTAAGACAAGG - Intergenic
914514919 1:148366081-148366103 TATAATTACTTTTTAAGTCAAGG + Intergenic
914597331 1:149166517-149166539 TATAATTACTTTTTAAGACAAGG + Intergenic
915290892 1:154882531-154882553 TTTAATGACATTTCAGTGCTGGG - Intergenic
916164191 1:161950348-161950370 TTTAATTGCATTTAAAATCAAGG - Intronic
916186255 1:162136280-162136302 TTTATTTATTTTTTAATGTATGG + Intronic
916668713 1:166991302-166991324 TTTAGCTAAATTTTAATGTATGG + Intronic
917783579 1:178427218-178427240 TTTAAGTGCATTTGAATGAAAGG - Intronic
918492894 1:185101380-185101402 TTTCACTACATATTAAAGCAGGG - Exonic
918825845 1:189323475-189323497 TTTAAATACATTTTTGTGAAAGG - Intergenic
918840205 1:189525998-189526020 TTTATTGTCTTTTTAATGCAAGG + Intergenic
918862500 1:189849497-189849519 TTTCATTTCATGTTAATGAAAGG - Intergenic
918994709 1:191742225-191742247 TTTCATTATCTTTTAATGCTAGG + Intergenic
919230860 1:194772250-194772272 TTTTTTTACAATTTAATGAATGG + Intergenic
919677970 1:200405689-200405711 TTAATGTACATTTTAATGAAAGG - Exonic
920941551 1:210488029-210488051 TTTAATTACATACAGATGCATGG - Intronic
921865854 1:220087116-220087138 TATAAATACATTTCAATGCATGG + Intronic
922164370 1:223102793-223102815 TCTATATACATTTTAATGCTGGG + Intergenic
922407328 1:225328763-225328785 GTTACTTACATATTAACGCATGG - Intronic
923329895 1:232913273-232913295 TTTATTTAGTTTTTAATGGATGG + Intergenic
924404535 1:243729181-243729203 TTTAATAAAATTTTATTGCATGG - Intronic
1063615332 10:7595211-7595233 TTTATTTACATTTTAGAGCTAGG - Intronic
1064424606 10:15219398-15219420 TTAAAGTTCATTTTAATGCGTGG + Intronic
1064441856 10:15360926-15360948 GTTAATTTTATTTTAATCCATGG - Intronic
1064655336 10:17550656-17550678 TTTAATTACATTCAAATTAAGGG + Intergenic
1064689139 10:17895920-17895942 TTTAATTACATGCAAATGAAGGG + Intronic
1064799949 10:19059110-19059132 TTTAAATAAATTATGATGCATGG + Intronic
1064811496 10:19204634-19204656 CTTAATTAAATTATAATCCATGG - Intronic
1064875574 10:19990458-19990480 TTGAATTACATTTTTATAAAAGG - Intronic
1064938050 10:20702359-20702381 CATGGTTACATTTTAATGCATGG - Intergenic
1064961919 10:20974542-20974564 TTAAATTACATTTCAAGGCTGGG - Intronic
1065043945 10:21728437-21728459 ATTAATTAGATTTTAATAAATGG - Intronic
1065710315 10:28510317-28510339 TTACAGTACATTTTAATGTATGG + Intergenic
1066209198 10:33220408-33220430 TTTAATTACTTTTTAGTGAGTGG + Intronic
1066248166 10:33605108-33605130 TGTACTTACATTTTACTGAAAGG + Intergenic
1066535959 10:36391909-36391931 TAAAATTATATTTTAATGCATGG + Intergenic
1066643682 10:37582745-37582767 TAAAATTATATTTTAATGAAAGG + Intergenic
1066691193 10:38030390-38030412 ATTCATTCCATTTTAATGCTGGG - Intronic
1068297213 10:55087860-55087882 TTTTATTAGATTTTAATGTTAGG - Intronic
1068426612 10:56873836-56873858 TTTAATTAGCTTTTGAAGCAGGG + Intergenic
1069213204 10:65787468-65787490 TTTAATCAGAGTTTAATGAAAGG - Intergenic
1069310522 10:67029813-67029835 TTTAATTAAAATTAAAAGCACGG + Intronic
1069315080 10:67088608-67088630 TCTAAATGCATTTTGATGCAAGG + Intronic
1070184888 10:74052010-74052032 TTTAATTATATTCTAATTAAGGG + Intronic
1070221464 10:74450461-74450483 TTTATTATCTTTTTAATGCAAGG - Intronic
1070420407 10:76230816-76230838 TTTAATTACATTTTAGTTCATGG + Intronic
1070425378 10:76281950-76281972 TGTATTTACATTTTCAGGCAGGG - Intronic
1071046066 10:81379250-81379272 TTAATTTACACTTTAATGGACGG - Intergenic
1071207548 10:83298742-83298764 TATAATAACATTTTAAAACATGG + Intergenic
1071350415 10:84735325-84735347 TTTAATTACATATTAATTCCAGG + Intergenic
1071410299 10:85385046-85385068 TTTAATTTCCTGTTATTGCATGG - Intergenic
1071792930 10:88975064-88975086 TGTAATAACAGTTAAATGCATGG - Intronic
1071798501 10:89031471-89031493 TTTACTCACATTTTAATCAAAGG - Intergenic
1072374978 10:94805040-94805062 TTTTATTTCATTTTCTTGCATGG + Intronic
1072463256 10:95639717-95639739 TTCAATTAATTTGTAATGCAGGG - Intronic
1073522007 10:104140807-104140829 TTTATTTTTATTTTAATTCAAGG - Intronic
1073887249 10:108053983-108054005 ATTAATTTCATTTTAATACTCGG + Intergenic
1073901034 10:108221330-108221352 TATAATTACATTTCAAAGGATGG + Intergenic
1074071064 10:110070032-110070054 TTTAATAAACTTTTAATACATGG - Intronic
1074812819 10:117122848-117122870 CTTTATTACATTTTTATACAAGG + Intronic
1077244839 11:1531683-1531705 TTTAATAATATTTTGATGAATGG - Intergenic
1077506111 11:2930635-2930657 TTTAAATACATTTTGAATCAGGG - Intergenic
1078504573 11:11924782-11924804 TTTAATGTCCTTTTAATGCAGGG + Intronic
1078784857 11:14479540-14479562 TTAAAATACATTTAAATGTAAGG - Intronic
1078814712 11:14808148-14808170 TTTGATTATATTTTTAAGCATGG - Intronic
1078885295 11:15493987-15494009 CTTAATTTCCTGTTAATGCAGGG - Intergenic
1079600114 11:22300782-22300804 TTTAATTTCTTTTTATTTCAAGG + Intergenic
1079872160 11:25812170-25812192 GATATATACATTTTAATGCAAGG + Intergenic
1080095537 11:28401853-28401875 TTTACTTTCATTGTAATTCAAGG + Intergenic
1080232803 11:30036569-30036591 TTCAAGAACATTTTAATGGAGGG - Intergenic
1080342105 11:31276522-31276544 TTTTATTACATTTTAATTCTTGG - Intronic
1080483968 11:32685156-32685178 TTTTATTTTATTTTAATGGATGG + Intronic
1081663802 11:44904593-44904615 TTTAAGTGCATTTGAATCCATGG - Intronic
1082264401 11:50104028-50104050 TTTAATAACATATCAATGAAGGG - Intergenic
1082920536 11:58487688-58487710 TTTATTTACATCTTACTGAAAGG - Intergenic
1082961966 11:58927149-58927171 TTTAATTATTCTTTAATTCATGG + Intronic
1085967394 11:81544283-81544305 TTTAATTACTTTTTAAAGAATGG + Intergenic
1087708725 11:101524557-101524579 TTTAAATACATTTAAATTTAAGG - Intronic
1087860504 11:103148642-103148664 TATTATTACTTTTTACTGCATGG + Intronic
1088093521 11:106072563-106072585 TTAAATCAAATTTTAATGGAAGG - Intronic
1089034263 11:115369491-115369513 TTCAATTAAATTTTAAAGCCGGG + Intronic
1089359925 11:117878942-117878964 TTTAATTACACGTTTATTCATGG - Intergenic
1089907440 11:122055591-122055613 AATTATTTCATTTTAATGCAAGG - Intergenic
1090478073 11:127042367-127042389 TTTAATTTCATTTTAACATACGG - Intergenic
1091200530 11:133776896-133776918 TTTAATACCAGTTAAATGCAGGG - Intergenic
1091622893 12:2102595-2102617 TTTAATTACACTTAAATTCTGGG + Intronic
1091849753 12:3686033-3686055 TTCAATTATCTTTTAATGCTGGG + Intronic
1092174166 12:6391380-6391402 TATAATTTCATCTTCATGCAGGG - Exonic
1092747737 12:11689449-11689471 TTTCATTTCATTTTAAACCATGG + Intronic
1093217776 12:16383388-16383410 TGTGATTACATTTTTATACATGG + Intronic
1093315537 12:17645974-17645996 TTTATATACATTTGAATGAAAGG + Intergenic
1094029076 12:25990077-25990099 TATTATTACTTTTTAAAGCAAGG + Intronic
1094085090 12:26581666-26581688 TTAAATTAAATTTTAATCCTAGG - Intronic
1094206003 12:27841399-27841421 TTAAAGTACAATTTAATGCAAGG + Intergenic
1094430305 12:30360999-30361021 TTTATTAACATTTTATTGGAAGG + Intergenic
1095433168 12:42156292-42156314 TTGAATTACCTTGTAATTCAAGG + Intergenic
1095491737 12:42742256-42742278 TTTGATTATATTTTATTGCCTGG + Intergenic
1095789891 12:46154323-46154345 TTTAAGGATATTTTGATGCAGGG - Intergenic
1097596234 12:61635180-61635202 TGCAAATACATTTTTATGCAGGG - Intergenic
1097690206 12:62727954-62727976 TTAAATTGCATTTTAAGGCTGGG - Intronic
1097947999 12:65393969-65393991 TTAAAATACATTTTAATACAAGG + Intronic
1097990831 12:65831422-65831444 TTGAATTAAATTTTATTGGAAGG + Intronic
1098126323 12:67297390-67297412 TTTTATTTTATTTTAAGGCAAGG + Exonic
1098388819 12:69947535-69947557 ATGAATTAGATTTTAATCCATGG + Intronic
1098443576 12:70543466-70543488 TTTACTTATAATTTAATGTAGGG - Intronic
1098767642 12:74509652-74509674 TTTAATTAAACTTTAATTCATGG - Intergenic
1098986388 12:77017060-77017082 TTAAATTATTGTTTAATGCAGGG + Intergenic
1099044732 12:77703014-77703036 TTTAAATAATTTTTAATGCCAGG + Intergenic
1099123356 12:78720406-78720428 TTAAATTACATTAAGATGCAAGG + Intergenic
1099288187 12:80741611-80741633 TAAAATTAAATTTAAATGCACGG + Intergenic
1099468788 12:83020992-83021014 TTTAAATACATATTTATGAAAGG + Intronic
1099665944 12:85629525-85629547 TTTAATGACATTGAAATGAAGGG + Intergenic
1099842171 12:87979790-87979812 TAGAAATACACTTTAATGCATGG - Intergenic
1100208193 12:92374326-92374348 TTTAAAAACATTCTAATACATGG + Intergenic
1100234155 12:92641506-92641528 ATTATTTGCATTCTAATGCAAGG - Intergenic
1101289175 12:103349925-103349947 TTTAATTCCTTTGTAAAGCAAGG - Intronic
1102193284 12:111005597-111005619 TTTTATTACATTTTTATACAAGG + Intergenic
1102504807 12:113377207-113377229 TTTACTTAAATTTCAATGAATGG - Intronic
1103251341 12:119502625-119502647 GTTAATTAAATTTTAATTAATGG + Intronic
1103451832 12:121034573-121034595 TTTCATGACATTATAAAGCAAGG + Intronic
1104374890 12:128256683-128256705 TTTAAATACATTTAAAAGAATGG - Intergenic
1104834646 12:131780655-131780677 TTTAATTGCATTTAGAGGCAAGG - Intronic
1106535635 13:30640152-30640174 TTTCATAATATTTTAATTCATGG + Intronic
1107460359 13:40596191-40596213 TTTAATTTCCTTTTCATGAAAGG - Intronic
1108070757 13:46626098-46626120 TTTAATTAAATTTTAAGCCTGGG + Intronic
1108332371 13:49401756-49401778 TTTATTTACATTTTTAAACAAGG - Intronic
1109065987 13:57691740-57691762 ATTATTTAAATTTTAATTCATGG + Intronic
1109551459 13:63907310-63907332 TTTATTTACTTTTTAATAGAAGG - Intergenic
1109746082 13:66624377-66624399 TTTTGTTACCTTTTACTGCAGGG - Intronic
1110002232 13:70217509-70217531 TTGAAGAACATTTTATTGCATGG + Intergenic
1110293651 13:73837153-73837175 TTTATTTACTATTTAATGCAGGG + Intronic
1110400474 13:75084263-75084285 TATAATTACATTTTTCTGAAAGG - Intergenic
1110539848 13:76695798-76695820 TGTCATTACATTTAAATGCATGG + Intergenic
1111229350 13:85322237-85322259 TTAAATTACAGTTTCATGTAGGG - Intergenic
1111230398 13:85338003-85338025 ATTAATTACATTGTAATAAAAGG + Intergenic
1111377317 13:87397460-87397482 TTTAATTAAATTGTGATTCATGG + Intergenic
1111849793 13:93558376-93558398 TTTATCTGCATTTTAATTCATGG - Intronic
1111922628 13:94428357-94428379 TTTAACTTCATTGGAATGCAAGG - Intergenic
1112725998 13:102305385-102305407 TATTATTATATTTTAAAGCAGGG - Intronic
1114131567 14:19799383-19799405 TTTATTTTAATTTTTATGCATGG - Intronic
1114285753 14:21241311-21241333 TTTAATTTGAATTGAATGCAGGG - Intronic
1114303748 14:21401879-21401901 TTTAATTATGTTTTTATGCTGGG - Intronic
1114730557 14:24988510-24988532 TTTAATTACATTTCAAGGGTAGG - Intronic
1115476895 14:33823712-33823734 TTTATTTATATTTTATTGTACGG - Intergenic
1115497644 14:34022358-34022380 TTTGATTACAGATTAATGAAAGG + Intronic
1115950110 14:38711532-38711554 TTTGATTAGATTTTCATTCATGG - Intergenic
1116270258 14:42755477-42755499 GCTAATTACATTTCAATGTAAGG - Intergenic
1116507622 14:45704161-45704183 TTAAATTACATTTTAGGGCCGGG - Intergenic
1116585886 14:46703521-46703543 TTGAATTTCATTTAAGTGCAAGG + Intergenic
1116904066 14:50388263-50388285 TCTAATTAGATTCTAATGCTAGG + Intronic
1116971967 14:51075683-51075705 TTTAATTCCATTTTATTTCAAGG - Intronic
1119343430 14:73900949-73900971 CTTCATTACATGTTAGTGCAAGG - Intronic
1119629309 14:76213488-76213510 TTATTTTACATTTTAAAGCATGG + Exonic
1120023522 14:79556292-79556314 TATAATTCCATTTTTATGTAAGG + Intronic
1120578742 14:86218999-86219021 TTTAATTAAATTTCAATTAATGG - Intergenic
1120671980 14:87373069-87373091 TTAAACTTCATTTTCATGCAAGG + Intergenic
1121156810 14:91693263-91693285 TTTTCTTACTTTTTAATCCATGG - Intronic
1121588555 14:95081511-95081533 TTTAATTATTTTTTAAGGCAGGG - Intergenic
1121761097 14:96445753-96445775 TTTATTTTCATTTTATTGAAAGG + Intronic
1123538687 15:21263761-21263783 TTGAAATACATTTTTATGAAAGG + Intergenic
1123538790 15:21265397-21265419 TTGAAATACATTTTTATGAAAGG - Intergenic
1123723255 15:23078492-23078514 TTCATATACATTTTAAAGCATGG - Intergenic
1124397380 15:29315320-29315342 TTTAAATACATTTTAATATCTGG - Intronic
1124688748 15:31804375-31804397 TTTAAGGACATTCTAATTCAGGG - Intronic
1124781981 15:32644699-32644721 GTTAATTTCAGTTAAATGCAAGG + Intronic
1125177510 15:36841692-36841714 TTTTATTACATTTTACAGCAGGG + Intergenic
1126168289 15:45672339-45672361 TTTGAAAACATTTAAATGCAAGG + Intronic
1126590273 15:50332316-50332338 TTTGATTAGACTTTACTGCATGG - Intronic
1126644847 15:50865090-50865112 TTTAATTACTTTTTATGGCTGGG + Intergenic
1127185663 15:56477482-56477504 TATATTTACTTTTTAATGAAAGG + Intergenic
1127948233 15:63777010-63777032 TTTAATTACAAAATATTGCAGGG + Intronic
1128058122 15:64716061-64716083 TTTTATTACATTTATATGTATGG - Intergenic
1128915621 15:71558829-71558851 TTTAATTATATTTTTAAGTATGG + Intronic
1129575609 15:76741110-76741132 TTTAGTTCCATTTTAAGGGAAGG - Intronic
1129644271 15:77416033-77416055 CTTAGCTACATTGTAATGCATGG - Intronic
1129745027 15:78012503-78012525 TTTTATTAGTTTGTAATGCATGG - Intronic
1130718936 15:86367057-86367079 TTTAATTTCATTTAATTTCATGG + Intronic
1130821210 15:87497698-87497720 TTTAATTCCAATTTGATGGACGG + Intergenic
1131110767 15:89763434-89763456 TTAAATTAAATTTTATTGCTGGG + Intronic
1131720577 15:95163993-95164015 ATTAATTAAATTTTAATTCAGGG - Intergenic
1131989045 15:98075219-98075241 TTTAGTAACATTTTAGTGCATGG - Intergenic
1133243084 16:4427678-4427700 TTTAATTATTTTTTAAGACAGGG + Intronic
1133513793 16:6486773-6486795 TTTTCTTTCATTTTCATGCAGGG + Intronic
1134322532 16:13176710-13176732 ATTAATTACATTTTACTTCTTGG - Intronic
1135094150 16:19550041-19550063 TTTAGATACATATTAATTCAAGG - Intronic
1135978679 16:27129232-27129254 TTAAATTACATTTGAATTCTTGG - Intergenic
1138190644 16:55010868-55010890 TTTGATTACGGTTTATTGCAAGG + Intergenic
1139026666 16:62826227-62826249 TGTATTTATATTTTACTGCAAGG + Intergenic
1139161277 16:64513687-64513709 GTTATTTACATTTACATGCAAGG - Intergenic
1140181743 16:72727108-72727130 TTTTATTATATATTATTGCAAGG - Intergenic
1140619499 16:76711534-76711556 TTTAAGTCCATTTAAATTCATGG + Intergenic
1140844519 16:78873778-78873800 TTTATTTACTTTTTGAGGCAGGG - Intronic
1142678159 17:1528432-1528454 TTTAAATACAGTTTAAGGCACGG - Intronic
1143604508 17:7974417-7974439 TGTCATTTCATTTTTATGCATGG - Intergenic
1143933088 17:10451715-10451737 TGTAATTACATTTTTTTTCATGG + Intronic
1144051966 17:11504635-11504657 TTTATTTACAACTTAATCCAAGG + Intronic
1145376590 17:22355047-22355069 TGTAATTGCATTTTACTGAATGG + Intergenic
1146246593 17:31289550-31289572 TTTTGTTACTTTTTAATACATGG + Intronic
1147548365 17:41420564-41420586 TTTATTGACCATTTAATGCAGGG + Intergenic
1147734825 17:42629393-42629415 TTTAATTACATTACATTGCTGGG - Intergenic
1149023606 17:51998728-51998750 TTTAATTCCACTTTAATGCTAGG + Intronic
1149106191 17:52969370-52969392 TTTGATTACTTTTTGTTGCAAGG + Intergenic
1149983732 17:61331645-61331667 TTTAATTTCTTTTAAATGGAAGG + Intronic
1150575099 17:66423720-66423742 TTTAAATATTTTTTACTGCATGG - Intronic
1151255869 17:72876005-72876027 TTTAATTACATTTAGATTAAGGG - Intronic
1151737390 17:75952587-75952609 GTTAATTAAATTTTAAGGCCAGG - Intronic
1151893673 17:76966113-76966135 AATAATTACTTTTTAATGGATGG - Intergenic
1151950197 17:77348861-77348883 TTTAATTTCTTTAAAATGCATGG - Intronic
1152731773 17:81975894-81975916 TTTAATAACTTTTTAAAGAAGGG + Intergenic
1155269342 18:24124290-24124312 TTTTTTTAAATTTTAATGAATGG + Intronic
1155312971 18:24542821-24542843 TTTTATTGCATTTTTTTGCAAGG + Intergenic
1155615009 18:27712146-27712168 TTTATTTACATTTCTCTGCATGG - Intergenic
1155620717 18:27775759-27775781 TTTAATGACATTTTGTTGTAAGG - Intergenic
1155711591 18:28887110-28887132 TTTAAATACGTATTAATGTAAGG - Intergenic
1156141943 18:34123227-34123249 TATAATTCAATTTTAATGAATGG + Intronic
1156142820 18:34137131-34137153 TTTAATTTAATTTTTATGTATGG - Intronic
1156160448 18:34351815-34351837 TTTAATTACATGTAAATTAAGGG - Intergenic
1156274225 18:35567021-35567043 CTTTATTTCATTTTATTGCAAGG - Intergenic
1156601571 18:38613648-38613670 TTTAATTACAGTAGAAGGCAAGG - Intergenic
1156816672 18:41319839-41319861 TTTAAATAAATCTTAATGAATGG - Intergenic
1156819167 18:41351277-41351299 TTTATTTATCTTTTAATACATGG + Intergenic
1158153407 18:54398324-54398346 TGTTATTATATTTTAATGCCTGG + Intergenic
1159388271 18:67755620-67755642 TTTTCTTACATTTTAATAAATGG - Intergenic
1159473725 18:68890183-68890205 TTTACACACAGTTTAATGCACGG + Intronic
1159686997 18:71434901-71434923 CTTAATTACTTTTAAATGTACGG - Intergenic
1159843651 18:73431571-73431593 TTTAATTACAACTTAATGAATGG + Intergenic
1161248118 19:3266114-3266136 TTTAATTACATTTAAATTAAGGG + Intronic
1161929362 19:7326311-7326333 TTTAAGTACATAATAATCCATGG + Intergenic
1163867572 19:19786860-19786882 TTTTATTTTTTTTTAATGCATGG - Intronic
1163974155 19:20833037-20833059 TTAAAATATATTTTAATTCAAGG - Intronic
1164013113 19:21225895-21225917 TTTAAAAACATTTTATTGCATGG - Intronic
1164503153 19:28836160-28836182 TAGAATTAGATTTTAAAGCAAGG - Intergenic
1164663834 19:30007843-30007865 TTTAAGTACATGTACATGCATGG - Intronic
1164774369 19:30840928-30840950 TTTATGAACTTTTTAATGCAAGG - Intergenic
1165940295 19:39411608-39411630 ATTAAGTACATTTTAATGTTAGG - Intergenic
1166458153 19:42961641-42961663 GTTTATTTCATTTTAAAGCATGG - Intronic
1166475091 19:43116893-43116915 GTTTATTTCATTTTAAAGCATGG - Intronic
1167145425 19:47678741-47678763 TTTTATTACATTTTACTGATGGG + Intronic
1167326353 19:48828601-48828623 TTTAATTACTTTTTGAGACAGGG - Intronic
925050287 2:808265-808287 TTAAAATACATTTTAAGGCCAGG - Intergenic
925093500 2:1174311-1174333 TAAAATTTCATTTTATTGCAAGG + Intronic
925452144 2:3978665-3978687 TTTAATGACATTTTAAGATAAGG + Intergenic
926424401 2:12728004-12728026 TCCAATTCCATTTTAATTCATGG + Intronic
926431562 2:12791733-12791755 TTTAAATACATTGTATTGAATGG + Intergenic
926817241 2:16811440-16811462 TTTATTTACATTTTGAGACAGGG + Intergenic
927578604 2:24221477-24221499 TTTATTTATTTTTTAATGCTGGG - Intronic
927584385 2:24286889-24286911 TTTTTTTACATATTCATGCAGGG + Intronic
929101364 2:38317913-38317935 GTTATTTACATTTCCATGCATGG - Intronic
930354674 2:50302803-50302825 TTTAATTGAATTTTAAAGGAAGG + Intronic
930407795 2:50983181-50983203 TTTAATTAGATTTAAATAAATGG - Intronic
930886346 2:56331384-56331406 TTTAATTTTATTTTAATTCTGGG - Intronic
931433335 2:62227423-62227445 TTTAATTTGATTGTAATCCAAGG + Intergenic
931452374 2:62379067-62379089 TTTAATTACCTATGCATGCATGG + Intergenic
931462693 2:62462265-62462287 TTTACTTACTTTTTGATGCAGGG - Intergenic
931955760 2:67422575-67422597 TTTTATTACATACTTATGCACGG - Intergenic
931977756 2:67661836-67661858 TTTTCTTTCATTTTATTGCAGGG - Intergenic
932997683 2:76876484-76876506 TTTTTTTACATTTTTATCCAAGG - Intronic
933152222 2:78929554-78929576 TTTAATTTCTTCTTAATGGAAGG + Intergenic
933448020 2:82407131-82407153 TCTAATTACTTTTTCATGCTTGG - Intergenic
934072965 2:88402160-88402182 TTTAATTTCCTTTTAATTCATGG - Intergenic
937666297 2:124490829-124490851 TTAATTTATATTTTAATACAGGG - Intronic
937720841 2:125093761-125093783 TTTAATTGCTATTAAATGCATGG + Intergenic
937932551 2:127218529-127218551 TTTAATTTAATTTTAATGCCAGG - Intronic
937932552 2:127218542-127218564 TTAAATTAAATTTTAATTCCCGG + Intronic
938275465 2:130017110-130017132 ATTAATTACATTTTATTAAAGGG + Intergenic
938326416 2:130407844-130407866 ATTAATTACATTTTATTAAAGGG + Intergenic
938439899 2:131320184-131320206 ATTAATTACATTTTATTAAAGGG - Intronic
939004973 2:136776304-136776326 TTTAATAACATCTTATTTCATGG + Intronic
940115586 2:150204821-150204843 TTAAATGACATTCTAATGAAGGG + Intergenic
940455621 2:153895148-153895170 TTTAATGCCATTTTAATCAATGG - Intronic
940556034 2:155230199-155230221 TTAAAGTACATTTTTATTCATGG - Intergenic
940612600 2:156009212-156009234 TTTATTTATATTTTAAATCAGGG - Intergenic
940780737 2:157931111-157931133 TTTTCTTACGTTTTAATGCTTGG + Intronic
941332680 2:164198277-164198299 GTTAATTCATTTTTAATGCAAGG - Intergenic
941396035 2:164974056-164974078 TTGAAATACATTTTTATGAAAGG - Intergenic
942925881 2:181431635-181431657 TTTAAATAGAATTTAATGTAAGG + Intergenic
943139024 2:183954981-183955003 TTTAAATACATTACTATGCAAGG + Intergenic
943187797 2:184635015-184635037 TTTAACCACTCTTTAATGCAAGG - Intronic
943305042 2:186250620-186250642 TTTAATTACAATTACAAGCATGG - Intergenic
943318763 2:186420315-186420337 TTAAATAACAGTTTATTGCAGGG + Intergenic
943480967 2:188417065-188417087 GTTAAATATATTTTGATGCATGG - Intronic
943801253 2:192060956-192060978 ATTAAATACATTTTAATGGCAGG - Intronic
944316588 2:198291565-198291587 TTTTTTTACTTTTCAATGCAAGG - Intronic
945070576 2:205984817-205984839 TTCCATTGCATTTTAAAGCAAGG + Intergenic
945392580 2:209282156-209282178 TTTAATTACTTATTAATTCCAGG - Intergenic
945744160 2:213700541-213700563 GTTACTTACATCTTAATGAAGGG + Intronic
945789151 2:214281818-214281840 GTTTATTACATTTTATTGTATGG - Intronic
945936748 2:215909991-215910013 TTTAATTACAGATGTATGCATGG - Intergenic
946081831 2:217127065-217127087 TTACATTACATGTTCATGCATGG + Intergenic
946942748 2:224786685-224786707 TTTAATTTCACTTTAATATATGG + Intronic
947383284 2:229565362-229565384 TTTACTTGCATTTGAATGTATGG - Intronic
947826810 2:233111763-233111785 TTTAATAACAATTTAAGGCCAGG + Intronic
948068957 2:235104402-235104424 TTTAAATGCCTTTTACTGCATGG - Intergenic
948388684 2:237597332-237597354 TGTAATTAAATTTAAAAGCACGG + Intronic
1169579836 20:7008527-7008549 TTTGGTTACATTTTAATACTTGG + Intergenic
1169818253 20:9681212-9681234 TTTAATTTTATTTTTTTGCATGG + Intronic
1170111313 20:12807102-12807124 TTTTATTACATTTTAATCCTAGG - Intergenic
1170238032 20:14130144-14130166 TTTTCTTACATTTTTATGAATGG + Intronic
1170323017 20:15122193-15122215 TTTCAAAACATTTTAATGCCAGG - Intronic
1170503597 20:17000429-17000451 TATAATTACATTTTACTTCCAGG - Intergenic
1171149733 20:22816915-22816937 TTTAATTTTATCTTAATGTATGG + Intergenic
1172256541 20:33523422-33523444 TGTAATTAAATTATAATTCAGGG - Intronic
1172388410 20:34549647-34549669 TTTAATGACATCCTAATTCAGGG + Intronic
1173712432 20:45171849-45171871 TGTCATGACATATTAATGCAAGG - Intergenic
1174338476 20:49881495-49881517 TTTAATCACTTTTTAAAGGACGG + Intronic
1174671312 20:52310384-52310406 TTTTATTTCATTTTAATTAATGG - Intergenic
1175132394 20:56799229-56799251 TTTAACTGGATTTTAAAGCAAGG + Intergenic
1175251730 20:57613983-57614005 TTAAATTACATTGTATAGCAAGG + Intronic
1175747981 20:61474665-61474687 TGTAATTACATTTTAAAGAAAGG - Intronic
1176905849 21:14500359-14500381 TTTTATTACTTTTTTATGCAAGG - Intronic
1177027508 21:15937920-15937942 TTTAAGTTCATTTTCCTGCATGG + Intergenic
1177203526 21:17984498-17984520 TTTAATTATATTTTCATAAAGGG - Intronic
1177538568 21:22461815-22461837 TTTAATTTTATTTCAATTCATGG - Intergenic
1177615822 21:23517739-23517761 TTTAATTACAATTTTAACCAAGG - Intergenic
1177712004 21:24789335-24789357 TGTAATTACATTTTTATTCTAGG + Intergenic
1177712481 21:24797035-24797057 TTTATTTCCATTTTAGTACATGG + Intergenic
1178255711 21:31050495-31050517 CTAAATTACTTTTGAATGCATGG - Intergenic
1178437254 21:32570881-32570903 TTTCATGACATTTTATTGGAGGG - Intergenic
1178781569 21:35608195-35608217 TTTTAGTACATTTTAATTCTGGG - Intronic
1183174217 22:36210916-36210938 TTAAAGTACATTTCAATGCTGGG - Intergenic
1184866910 22:47206469-47206491 TTTAATTACATGTAAATTGAGGG - Intergenic
949785955 3:7742102-7742124 TTTAAATACATTTTACTGTTTGG - Intergenic
950740645 3:15048955-15048977 TGCCATTACATTTTAATGCCAGG + Exonic
951205724 3:19924169-19924191 ATTAATTGCATTATACTGCAAGG + Intronic
951365398 3:21775239-21775261 TTTATTAACTCTTTAATGCAGGG + Intronic
951605463 3:24429115-24429137 ATAAGTTACATTTTAATACATGG + Intronic
952243920 3:31564073-31564095 TTTAATTAAATTTTCATTCAGGG - Intronic
952667911 3:35929602-35929624 TTTAATGTCATTTTAAGCCAAGG - Intergenic
953231391 3:41068081-41068103 TTTAATCACAGTTTAAAGAAAGG - Intergenic
955552706 3:60101204-60101226 TTCAATGACTTTTCAATGCATGG + Intronic
956673381 3:71712410-71712432 TTTAATTATTTTTTAAATCAGGG + Intronic
956901461 3:73720668-73720690 TTTAATAACATGTTATTCCAGGG + Intergenic
957316102 3:78578809-78578831 TCTCATTACCTTCTAATGCAAGG - Intergenic
957366395 3:79229958-79229980 TGAAATTACATTTTAATACTAGG - Intronic
957502407 3:81074195-81074217 TTTCATTAAAATTTAATTCAGGG + Intergenic
957519992 3:81307028-81307050 TTCATTTATATTATAATGCATGG - Intergenic
957807898 3:85174745-85174767 TTTCATTACGTTTTAATGATCGG - Intronic
957895688 3:86418840-86418862 TTAAATTGCATTTTAAAGCTAGG - Intergenic
958131302 3:89428390-89428412 TTTAAATACATTAAAATGCTGGG + Intronic
958603160 3:96325306-96325328 CTTATTTATATTTTAATACAGGG - Intergenic
958720459 3:97837236-97837258 TTTGATCACATTTTAAGGGAAGG + Intronic
959318436 3:104840023-104840045 TTTAAATAAATTTTAAGACAGGG + Intergenic
959322236 3:104891473-104891495 CATATTTACATTTTAATTCAAGG - Intergenic
959761380 3:109969629-109969651 TTTAATTGCATATAAATCCACGG - Intergenic
960392916 3:117101227-117101249 TTTAATGACTTTTTACTTCATGG - Intronic
960461371 3:117939947-117939969 TTTAATTACTTTTACATGTAAGG - Intergenic
960462540 3:117953952-117953974 TTTAATCACAAATTAATGCGTGG - Intergenic
961247031 3:125463654-125463676 TTTAATTATACTTTAAAGCTAGG - Intronic
962300504 3:134238139-134238161 TTTAACTACATTATAAGACAAGG + Intronic
962832717 3:139158520-139158542 TTCAATTACAATTTACTCCATGG - Intronic
963093195 3:141506426-141506448 TTTACTTGCATTTGAATGAAAGG - Intronic
963376692 3:144476011-144476033 TTTTATTACAGTGTGATGCAGGG + Intergenic
963530308 3:146466488-146466510 ATTATCTACATTTTAATTCAAGG - Intronic
963614764 3:147522602-147522624 TTTATGTACATTTTTAAGCATGG - Intergenic
964095128 3:152922475-152922497 TTTATTTACATGTATATGCAAGG - Intergenic
964421618 3:156509994-156510016 TAGAATTAAATTTTAATTCATGG + Intronic
965072305 3:163930160-163930182 TTTAATTTAATTTTAATATAAGG - Intergenic
965193517 3:165562872-165562894 TTAAATTACAATTTAAAGCTTGG + Intergenic
965694345 3:171391707-171391729 TTTAATTACATACATATGCATGG - Intronic
966306299 3:178539207-178539229 TTTAATTATATTTTGATGAGAGG - Intronic
967023674 3:185545403-185545425 TTTTCTTGCAATTTAATGCATGG + Intronic
968709922 4:2106966-2106988 TGTATTTACATATTAATGTAAGG + Intronic
969188822 4:5500621-5500643 TTAAAAGACATTTTAATGTATGG + Exonic
969460123 4:7324566-7324588 TTTAATTACAGTGAAAAGCAGGG + Intronic
970180107 4:13383272-13383294 TTTATTTATTTTTTAATGGATGG - Intronic
970670089 4:18386737-18386759 TTTCATTTCATCTTCATGCAGGG + Intergenic
971346390 4:25815405-25815427 TTTAATTAGATTTCATTGCCAGG + Intronic
971867081 4:32186716-32186738 TTTAAAAACATTTTAAAACATGG + Intergenic
971971376 4:33624821-33624843 TTAAATTACATTTTTATGTATGG - Intergenic
971984335 4:33801456-33801478 TTAATTTATATTTTAATGCTGGG + Intergenic
972067695 4:34971395-34971417 TTTATTTACTTTTTAAGGCAAGG - Intergenic
972302951 4:37802933-37802955 TTTAAGTAGATTGTAATGCCTGG + Intergenic
973016868 4:45150786-45150808 TTTCATTAGGTTTTAATGAAAGG + Intergenic
974020969 4:56692132-56692154 GATAATTACATTTTAATTAAAGG - Intergenic
974751598 4:66148746-66148768 TTTTTTTAGATTTTAATGGAAGG + Intergenic
974865962 4:67581016-67581038 TTGAATTAGCTTTTAGTGCAAGG + Intronic
975038866 4:69719571-69719593 ATAAATTCCATTTTAAAGCAAGG - Intergenic
975146241 4:70970522-70970544 TTTAATTCCCTTTTGGTGCAAGG + Intronic
975492475 4:75003839-75003861 TTTATTTACATTTCAAAGCTAGG - Intronic
976074471 4:81281636-81281658 TTTGACTACATTATAAAGCAAGG + Intergenic
976294986 4:83461455-83461477 TTTAATTCCATTCTATTGAATGG - Exonic
976986379 4:91304300-91304322 TTTATTTACATTTAAAGGAAAGG + Intronic
977061698 4:92266450-92266472 TTTAATCACATTTTAAAGTTTGG + Intergenic
977139955 4:93357348-93357370 TTAAATTATTTTTTAATTCATGG - Intronic
977269304 4:94896496-94896518 TTTGATTATATGTTAATGCTGGG + Intronic
977456207 4:97263567-97263589 TTAAATTACTTTTGACTGCAAGG + Intronic
977770656 4:100854489-100854511 TTTAAATACATTTTCAAGAATGG + Intronic
978134261 4:105237749-105237771 TTTAAATATTTTTTAATTCAAGG + Intronic
978171739 4:105679652-105679674 TTTAGTTAAATTTAAAAGCATGG - Exonic
979230524 4:118343788-118343810 TATAAGTACATTTTAATGAGGGG - Intronic
979592800 4:122499739-122499761 TTTAATAACAATTTTATGTAAGG - Intergenic
979768450 4:124491794-124491816 TTTAACCATATTTGAATGCAGGG - Intergenic
980060704 4:128125988-128126010 TTTATTCACATTATATTGCAAGG + Intronic
980566066 4:134543670-134543692 TTTAATTACTTTTGAAAGCAAGG - Intergenic
980687133 4:136242917-136242939 TTTTATTAAATTTTAAACCAGGG + Intergenic
981319403 4:143374247-143374269 TTTAATCACATTCTGATCCATGG - Intronic
981595970 4:146422530-146422552 TTTAGTTACAGTTTTATACACGG - Intronic
982144548 4:152370206-152370228 TTTAATTACATTTTTATGTGTGG - Intronic
982149096 4:152432406-152432428 TTAAATTACATATTAATTGAAGG - Intronic
982707658 4:158727546-158727568 TTGAATTACACTTAAAGGCATGG - Intergenic
983138155 4:164111480-164111502 TTTAATTTTGTTTTAATGGAAGG - Intronic
983970064 4:173860526-173860548 ATTAATTATGTTTTCATGCAGGG - Intergenic
984460608 4:180031805-180031827 TTTAATTCCTTTTTATTGCCAGG + Intergenic
984485078 4:180357962-180357984 TATAATTACACTTTACTGGAAGG - Intergenic
984688603 4:182699548-182699570 TTTAATTACAGTTATATGCCAGG + Intronic
984779922 4:183515853-183515875 TGTAAGTACACTTTAAAGCAGGG + Intergenic
986106071 5:4660853-4660875 TATATTTTTATTTTAATGCATGG - Intergenic
986472542 5:8090281-8090303 GTTCATTACATTTTAAGGTAGGG + Intergenic
986585322 5:9310706-9310728 TTTAATTTCATATTAATAAAAGG + Intronic
987455771 5:18144334-18144356 TTTAGTTACATATTAGTGTAAGG - Intergenic
987544815 5:19300902-19300924 ATTAATTATATTACAATGCATGG - Intergenic
987596089 5:20001130-20001152 TTTCTTTTTATTTTAATGCATGG + Intronic
987624465 5:20380156-20380178 TTTAATAGCATTTTGATGGATGG + Intronic
987780954 5:22434658-22434680 TATAACGTCATTTTAATGCAGGG + Intronic
987804628 5:22747780-22747802 TTTAATTCTATTTTGCTGCAAGG - Intronic
987836802 5:23172635-23172657 TTTAATTATATTTTATTTTAAGG + Intergenic
988711163 5:33776475-33776497 TTTAATTTCATCTTGATCCATGG - Intronic
988958057 5:36338914-36338936 TTGAATTGCAGTTGAATGCAGGG + Intergenic
990639869 5:57770674-57770696 ATTAATTTCATTTAAATGCAAGG - Intergenic
990678127 5:58211808-58211830 TTTAAGCACATTTTAAAGAATGG - Intergenic
990910662 5:60848985-60849007 ATAATTTACATTTTATTGCATGG + Intergenic
991271613 5:64790047-64790069 TTTAATTACATTTTAATGCAAGG - Intronic
991458066 5:66826006-66826028 TTTTATTGCATTTTAACACATGG + Intronic
991748991 5:69778879-69778901 TTTAATAAAATTTGAATGTATGG + Intergenic
991800572 5:70358690-70358712 TTTAATAAAATTTGAATGTATGG + Intergenic
991828028 5:70651351-70651373 TTTAATAAAATTTGAATGTATGG - Intergenic
991892929 5:71358130-71358152 TTTAATAAAATTTGAATGTATGG + Intergenic
992171317 5:74104808-74104830 ATTACTTACATATTAATGGATGG - Intergenic
992382978 5:76256757-76256779 TATAATGACATTTTAAAGCGGGG - Intronic
992505159 5:77379857-77379879 TTTCATTACATGTAAATGAAGGG + Intronic
993472294 5:88320771-88320793 CTTAGTTACATTTTAAGTCAAGG - Intergenic
993580073 5:89650358-89650380 TTTAAATACATTTAACTGGAAGG + Intergenic
993623648 5:90197152-90197174 TTTTATTAGATTTTTATGGAGGG + Intergenic
993745363 5:91590749-91590771 ATTAATAGTATTTTAATGCAAGG - Intergenic
994474347 5:100248578-100248600 TTTAATTATATTTTAAGTTATGG - Intergenic
994971258 5:106742346-106742368 TTTAATTATATTTTAAGTCTAGG + Intergenic
995370472 5:111412888-111412910 TTTAATTACATATAAATTAAGGG - Intronic
995560245 5:113373515-113373537 TGTACTTACATTTTAATATATGG + Intronic
995602589 5:113814445-113814467 TTAAATTACATCCTAATGCTGGG + Intergenic
995791127 5:115888585-115888607 TATAATGACATTTTGTTGCAGGG + Intronic
995857550 5:116609183-116609205 TTTACTTACATTTGAATGGAAGG - Intergenic
995983006 5:118130818-118130840 TGTAATTACTAATTAATGCAAGG - Intergenic
996080152 5:119250164-119250186 TGTCCTTACATTTTTATGCATGG - Intergenic
996121597 5:119679875-119679897 TTTCATTATATTTTAAAGCATGG + Intergenic
996538668 5:124606102-124606124 TAAAATTATATTTTAATCCATGG + Intergenic
996613233 5:125409526-125409548 TTCATTTACAATTTAAAGCAAGG + Intergenic
997243484 5:132325995-132326017 TTTAATTACATGTAGATGAAAGG - Intronic
998285321 5:140854376-140854398 ACTCATTACATTTTAATTCAGGG + Intronic
999009237 5:148016861-148016883 GGTAATTACATATTAATACAAGG - Intergenic
999835872 5:155371582-155371604 TTTGATTTCTTTTTTATGCATGG - Intergenic
1000121525 5:158202519-158202541 TTTGTTCACATTTTGATGCATGG - Intergenic
1000213090 5:159127911-159127933 TTTGTTTACATTTTAAAGCCTGG + Intergenic
1000621522 5:163492194-163492216 TTTTATTAGATCTTAATACATGG + Intergenic
1000659799 5:163923499-163923521 TTTAATTACAATCTAATTAAAGG + Intergenic
1000664653 5:163980074-163980096 TTTCCTGACTTTTTAATGCAGGG + Intergenic
1000751869 5:165105840-165105862 AATGATTACATTTTAATGTATGG + Intergenic
1000778925 5:165454887-165454909 TTTAATTTTTTTTTAATACAAGG - Intergenic
1001790333 5:174451488-174451510 TTTTAGTCCATTTTTATGCATGG - Intergenic
1001807770 5:174602799-174602821 TTTGATTCAATTTTTATGCATGG + Intergenic
1002460405 5:179370448-179370470 TTTAATGACATCTTAAAGCAGGG - Intergenic
1002863341 6:1099435-1099457 TTTAAAAACATTCTAATGGATGG + Intergenic
1003004902 6:2372032-2372054 TTTCCTGACTTTTTAATGCATGG - Intergenic
1004244646 6:13961987-13962009 TTGAATGGCATTTTAATGAAAGG + Intronic
1004566227 6:16800402-16800424 GTTAATTTCATATTAATGCAGGG + Intergenic
1004979325 6:21005280-21005302 TTTGAATATATGTTAATGCATGG - Intronic
1005531238 6:26708778-26708800 TTTCATTTCATTTTAAGACAAGG - Intergenic
1005539558 6:26792858-26792880 TTTCATTTCATTTTAAGACAAGG + Intergenic
1005646932 6:27848422-27848444 TTTATTTACATTTGAAGGAATGG - Intronic
1006571014 6:35004325-35004347 TTAAATTACATTTTTAGGCTGGG + Intronic
1008000157 6:46351966-46351988 TTGATTTACATCTTAATGGAAGG - Intronic
1009671960 6:66765373-66765395 CTTAATTACATTTAATTACAGGG + Intergenic
1009878053 6:69530996-69531018 GTTTATTATGTTTTAATGCATGG - Intergenic
1010309158 6:74362989-74363011 TTAAATCACATTTAAATACATGG - Intergenic
1010365598 6:75047842-75047864 TTCAATAACTTTTTAATCCATGG - Intergenic
1010615069 6:78002549-78002571 TTTATTTACTTTTTAAGACAAGG - Intergenic
1010690816 6:78909465-78909487 TTTAATTATGTTTTCATTCAGGG - Intronic
1010736260 6:79446952-79446974 TATAATTCCAATTTAATCCAGGG + Intergenic
1010769637 6:79813481-79813503 TGTAATTATGTTTTAATGCTAGG - Intergenic
1010878006 6:81132626-81132648 TTTAATTAAATTTGAACTCAGGG + Intergenic
1011431957 6:87296908-87296930 TTTAATAATATTTAAATACAAGG + Intronic
1011803065 6:91040137-91040159 TTCAATAACATTTTAAAGAATGG - Intergenic
1011869855 6:91880259-91880281 TATAATTACTTCTTAGTGCAGGG + Intergenic
1012043886 6:94244274-94244296 TTTAATTAAATTTTAAGGTTTGG - Intergenic
1012305265 6:97648196-97648218 TCTACTCACATTTTATTGCAAGG + Intergenic
1012905395 6:105058763-105058785 TATAATGTCATTTTAATGTATGG + Intronic
1014163675 6:118199325-118199347 TATATTTACATTTTTATGCAAGG + Intronic
1014751967 6:125267035-125267057 TGAAATTACATTTGAATGCTAGG - Intronic
1014772438 6:125472539-125472561 TTTAAATCCATTTTACTGTAGGG - Intergenic
1014797595 6:125745004-125745026 TTTCATAGCTTTTTAATGCACGG + Intergenic
1015031952 6:128605759-128605781 TTTAAATAAATCTTAATCCAAGG - Intergenic
1015209812 6:130684150-130684172 TATAGTTACAGTTTAATGCTAGG - Intergenic
1016435580 6:144034107-144034129 GTTAATTACATCTCCATGCAGGG + Intronic
1016545805 6:145222121-145222143 ATTAAATACATTTCAAAGCAAGG + Intergenic
1016637230 6:146306630-146306652 TTAATTTACATTTTCATTCAGGG + Intronic
1016764967 6:147782443-147782465 TTTTATTGCATTATAATCCATGG - Intergenic
1017845972 6:158258645-158258667 TTGCTTTAAATTTTAATGCAAGG - Intronic
1018530601 6:164758971-164758993 TTTATTTACTTTTTTATTCAGGG + Intergenic
1018796527 6:167189776-167189798 TTTCATGACATTTTATTGGAGGG + Intronic
1018819794 6:167365341-167365363 TTTCATGACATTTTATTGGAGGG - Intronic
1019352340 7:560448-560470 TTTAGTTACTTTTTAATTTATGG - Intronic
1019400349 7:848602-848624 TTTAAATACCTTTTGATTCATGG - Intronic
1020352891 7:7241877-7241899 TTTATTTATATTTTACTGGATGG - Intronic
1020650212 7:10865811-10865833 TTTAATTACATTTGATTAAAAGG - Intergenic
1021069923 7:16224033-16224055 TCTAATTTCATTTTAATGAAAGG + Intronic
1021410117 7:20320513-20320535 TTTAATTATATTTTAAACCCTGG - Intergenic
1022220855 7:28312150-28312172 TTTCATTTCATTTTAGTGAAAGG + Intronic
1022788934 7:33667337-33667359 TTGAATTGCATTTCAATACATGG + Intergenic
1023309054 7:38864253-38864275 TCTAATTACATTTTATTTTATGG + Intronic
1023799848 7:43824420-43824442 TTTAATTACTCTTTAATTCATGG - Intergenic
1024446769 7:49489044-49489066 TTTAATTACATATGTGTGCATGG - Intergenic
1024920398 7:54547433-54547455 TTGAATGTCACTTTAATGCATGG + Intronic
1024933951 7:54692730-54692752 CTTAGTTACATTTCAATGTATGG - Intergenic
1025907692 7:65800699-65800721 TTTAATAACATATCAATGAAGGG + Intergenic
1026042509 7:66879838-66879860 TTTAATAACATGTCAATGAAGGG + Intergenic
1026204099 7:68240446-68240468 TTTAATTACATGTCATTGGATGG - Intergenic
1026515231 7:71063839-71063861 TTAACTTTCATTTTAATTCAGGG - Intergenic
1026544930 7:71313854-71313876 TTTAATTTCCTTTTAAAGCCAGG - Intronic
1026959585 7:74399852-74399874 TTTAATTATTTTTAAAGGCAAGG + Intronic
1027545925 7:79527594-79527616 TATAATTACATTATAATGTTTGG + Intergenic
1027658794 7:80964278-80964300 TTAAAATATATTTTAAGGCAAGG + Intergenic
1027811570 7:82907650-82907672 TATATTGACATTTTAATGGAGGG + Intronic
1027942110 7:84695644-84695666 TTTAAGTACATTTTTATCCATGG + Intergenic
1027979092 7:85194567-85194589 TTTAATCATATTTCAATCCAGGG + Intergenic
1028016453 7:85719716-85719738 TTTAATTTTTTTTTAATACAGGG - Intergenic
1028036063 7:85984124-85984146 TTTAATTTTTTTTTAATTCATGG - Intergenic
1028462253 7:91107628-91107650 TTTCATTCCACTTTAATGCTTGG - Intronic
1028528049 7:91807397-91807419 TTTAATTATATTTAAATTCTAGG + Intronic
1028799888 7:94950722-94950744 ATTAATTGCCTTTTAATTCATGG - Intronic
1029580380 7:101433316-101433338 TTTATTTATTTTTTGATGCAGGG - Intronic
1029972890 7:104806679-104806701 ATTAATTATTTTTTAGTGCAAGG + Intronic
1030962574 7:115945498-115945520 TTTAAATACATTTTATTCCTTGG - Intronic
1031144584 7:117983711-117983733 TTAAATTTCATTCTAAAGCATGG + Intergenic
1031333824 7:120500821-120500843 TTAAATTATATTTAAATGTATGG + Intronic
1031354213 7:120769894-120769916 TTTAATTTTATTTTAATTTAAGG - Intergenic
1031357596 7:120806349-120806371 ATTAATCACATTTTAATAAAGGG - Intronic
1031462392 7:122067666-122067688 TAATATTACATTATAATGCATGG - Intergenic
1031496245 7:122451809-122451831 TTTAATAATATTTTCATTCAGGG - Intronic
1031780490 7:125956108-125956130 TTTTATTTCATTTTAATTTAAGG + Intergenic
1032421790 7:131786299-131786321 TTTAATTATATGTTAATTAAGGG + Intergenic
1032598764 7:133270636-133270658 TTTTATTTTATTTTAATGGAAGG + Intronic
1033384217 7:140855588-140855610 TTTAATTACATTTTCTTTAAGGG - Intronic
1033664894 7:143431094-143431116 ATTAATTGCAGTTTAATACATGG - Intergenic
1033680917 7:143595738-143595760 TTAAATTACATTTAAATCCTAGG + Intergenic
1033703975 7:143866075-143866097 TTAAATTACATTTAAATCCTAGG - Intronic
1035134251 7:156685027-156685049 TTTAATTACATATTAATATTTGG - Intronic
1035236916 7:157503270-157503292 ATAAATTGCATTTTAATGTAAGG - Intergenic
1035876789 8:3198474-3198496 ATTATTTACATTTTAATAAAAGG + Intronic
1035939303 8:3878041-3878063 TCTAATTACATATTCATGCTGGG + Intronic
1036768487 8:11563707-11563729 TTTATTTACTTTTTATTGCCTGG - Intronic
1037153367 8:15668223-15668245 TTTAAGGACATTTTAAGACATGG + Intronic
1037161226 8:15775106-15775128 GTAAATAACATTCTAATGCATGG - Intergenic
1037524960 8:19715691-19715713 GGTAAATACATTTTAATGCCTGG + Intronic
1038337377 8:26656211-26656233 TTTAATTCCATATTAATACAAGG + Exonic
1038788082 8:30640528-30640550 TGTAATCAAATTTTAAGGCATGG + Intronic
1039202712 8:35114221-35114243 TTCAATTGCATTTTATTTCAGGG - Intergenic
1040939590 8:52818599-52818621 TTTAATTACATGTGGATGAAGGG - Intergenic
1041014815 8:53582398-53582420 TTTAATTATATTTTTATAGAAGG + Intergenic
1041462383 8:58125497-58125519 TTAAAAAACATTTTAATCCATGG + Intronic
1041538849 8:58959898-58959920 TTTAATTACAATTTGAAACAAGG + Intronic
1042153482 8:65815307-65815329 TTAAATAACATTCTAATGCAAGG + Intronic
1042481249 8:69305944-69305966 TTTAATTAGATTTTGATCCATGG + Intergenic
1042876639 8:73446554-73446576 TTTAATTATATCTAAATGCAAGG + Intronic
1043047441 8:75344470-75344492 TTACATTACAATTAAATGCATGG + Intergenic
1043115204 8:76242993-76243015 TTTAAATTTTTTTTAATGCAAGG - Intergenic
1043132215 8:76475435-76475457 GTTAAGGACATTTTAATTCAGGG + Intergenic
1043210105 8:77503197-77503219 TTTATAAACATTTTAATGCTTGG + Intergenic
1043952122 8:86320945-86320967 TTTATTTACATTTTACTGGAAGG + Intronic
1044417970 8:91957533-91957555 TCTCATTACTTTTTAATTCAGGG - Intronic
1045107574 8:98907844-98907866 TTTAATTATCTTTTAATCTATGG + Intronic
1045257761 8:100543916-100543938 TTTAATTATATTTTATTGGATGG + Intronic
1046229378 8:111333338-111333360 TTTTATTTTATTTTAATTCAGGG - Intergenic
1046833282 8:118771440-118771462 TGTAATTAATTTGTAATGCATGG + Intergenic
1047071810 8:121353583-121353605 TTAAAACACATTTTAATTCAAGG + Intergenic
1047982910 8:130201773-130201795 TTTAATTTCATTTCCACGCATGG + Intronic
1048612836 8:136042367-136042389 TTTAATTTTATTTTAAAGCTGGG + Intergenic
1048780380 8:137992670-137992692 TTTTTTTAAATTTTAATTCAGGG + Intergenic
1049291105 8:141802438-141802460 GTTAAATACAGTTTAATACATGG - Intergenic
1050285874 9:4101173-4101195 TTTATTTCCATTTTAAGGCGAGG - Intronic
1050299359 9:4241611-4241633 TTTAAAAAAAATTTAATGCAAGG + Intronic
1050464696 9:5909592-5909614 TCTAATTACATTTCACTTCAAGG + Exonic
1051005906 9:12344050-12344072 TTTAATTTCATTTTTCTGCAAGG - Intergenic
1051393828 9:16596778-16596800 TTTCATTACATATTCATGCTAGG + Intronic
1051698961 9:19799002-19799024 TTTCATTTCATTTTATTTCATGG + Intergenic
1052469069 9:28869908-28869930 TTTAAAGACATTTTTATGTAAGG - Intergenic
1052484257 9:29075812-29075834 ATTAATTAGATTTTGATGTAAGG - Intergenic
1052959597 9:34283829-34283851 TTTAATTATATTTTATTGTGGGG - Intronic
1053328226 9:37176573-37176595 TGTAATTATATTTTAATATATGG + Intronic
1053623662 9:39845788-39845810 TTTAATTACATGTAGATTCAGGG - Intergenic
1053881207 9:42597440-42597462 TTTAATTACATGTAGATTCAGGG + Intergenic
1054220236 9:62404911-62404933 TTTAATTACATGTAGATTCAGGG + Intergenic
1054230479 9:62504261-62504283 TTTAATTACATGTAGATTCAGGG - Intergenic
1055542419 9:77325343-77325365 GTTAAATATACTTTAATGCATGG - Intronic
1055811719 9:80156575-80156597 TTTAATTTATTTTTAATGCCTGG - Intergenic
1055840385 9:80496090-80496112 TTTAATTGTATTTTAATCTAGGG - Intergenic
1056151355 9:83792781-83792803 TTTATTTGCATTTTATTGCCTGG - Intronic
1056187701 9:84151934-84151956 CCTAATTACAATTTGATGCAGGG - Intergenic
1056566978 9:87782236-87782258 ATTATTTACATTTTATTGTAGGG - Intergenic
1056794172 9:89646005-89646027 TGGAGTTACATTTTTATGCATGG - Intergenic
1056905560 9:90644711-90644733 TATAAATACATTTTAAAACAAGG + Intergenic
1056968420 9:91183288-91183310 TTTGATTACAATTTAAGGCTGGG + Intergenic
1057005791 9:91557665-91557687 TTTAATTAAATTTCATTTCATGG - Intergenic
1059685953 9:116636368-116636390 TCTAAGTACATCTTAATGTATGG - Intronic
1059712302 9:116879961-116879983 TTTAAATACATTTTGATAAATGG - Intronic
1059780707 9:117523359-117523381 TTAAATTACATAATAATGAAAGG - Intergenic
1061126433 9:128679468-128679490 ATTAATTACTTTTTGAGGCAGGG + Intergenic
1203769643 EBV:42757-42779 TTTGGTTAAATTATAATGCATGG - Intergenic
1186069845 X:5807672-5807694 TTTAATTATGTATTCATGCAGGG - Intergenic
1186184682 X:7008679-7008701 GTTTATTTCATTTTAAAGCATGG - Intergenic
1186646536 X:11512972-11512994 TTTATTTTCATTTTAATGAAAGG + Intronic
1186806494 X:13145283-13145305 TGTGATTAAATTTAAATGCAAGG + Intergenic
1186814756 X:13225462-13225484 TTCAATGACAGATTAATGCAGGG + Intergenic
1187299511 X:18034036-18034058 TTCAATCCCAATTTAATGCAGGG - Intergenic
1187665012 X:21597596-21597618 TTTAATTACTTGTTAATAGAAGG + Intronic
1187761472 X:22591082-22591104 TTAATTTATATTTTAATGGAGGG - Intergenic
1187942646 X:24396982-24397004 TTTTCTTACATTTTATTTCAAGG + Intergenic
1188127054 X:26382244-26382266 TTTATTTACAGTTTAAAGTATGG + Intergenic
1188246550 X:27841577-27841599 TTTAATTTTATTTTAAAGAAAGG - Intergenic
1188532935 X:31162708-31162730 CTTGATAACATTTTAATACAAGG + Intronic
1188613649 X:32130887-32130909 TGTTATTACTTTTTAATGCCAGG + Intronic
1188644609 X:32550344-32550366 TTGATTTCCATTTTAATGTATGG - Intronic
1188825602 X:34829973-34829995 TATATATACATTTTAATACATGG + Intergenic
1188879266 X:35471796-35471818 TTTATTTACATTTTTAGGTATGG + Intergenic
1188925629 X:36039304-36039326 TTTTGTTAAATTTTAATGTATGG - Intronic
1189103352 X:38213130-38213152 TGTAATTCCATTTTTATGGAAGG + Intronic
1190957777 X:55212450-55212472 TTTGAGTTCATTTTAATGAAAGG + Intronic
1191261268 X:58324645-58324667 TTTAACTACTTTGTGATGCATGG + Intergenic
1192771478 X:74196016-74196038 TTTAAGAACATTTTTATGAAGGG - Intergenic
1193804196 X:85973719-85973741 TTTAATTATATGCTAATGCTGGG - Intronic
1193919489 X:87407742-87407764 TTTTATTACATTGTAATGGCAGG + Intergenic
1193948894 X:87774047-87774069 GTTAATTTCATTTTAATTTAAGG + Intergenic
1194067160 X:89275987-89276009 TTTAATTACATGCAAATGAAGGG + Intergenic
1194432152 X:93822180-93822202 TTTAACTACATTATAAGGCCAGG + Intergenic
1194468710 X:94265646-94265668 CTTAATTTCATTTTCATTCAGGG - Intergenic
1194511533 X:94802047-94802069 TGTAATTACATTCTAATCAATGG + Intergenic
1194569796 X:95541684-95541706 TTAAATTAATTTTTAATGGATGG - Intergenic
1194986582 X:100496280-100496302 TTTATTTACAATTTGATGCATGG + Intergenic
1197343715 X:125306130-125306152 TTGAATTTCATTTGTATGCAAGG - Intergenic
1197766316 X:130061333-130061355 TTTAATTACGTGTTTATGTAGGG - Intergenic
1197832146 X:130654651-130654673 TTTCAATTCATTTTAATTCAAGG - Intronic
1198517319 X:137422789-137422811 TTTAATTCCACATTAATCCAGGG + Intergenic
1199407430 X:147478877-147478899 TTTAATTATATTTTTGTGCATGG + Intergenic
1200721321 Y:6610196-6610218 TTTAATTACATGCAAATGAAGGG + Intergenic
1201369812 Y:13251443-13251465 TTGAATTACACTTTAGTGAATGG - Intronic
1201626116 Y:16016456-16016478 TTTAATTACATTTTTAAGCTAGG - Intergenic
1201669355 Y:16500015-16500037 TTTAATTACATGCAAATGAAGGG + Intergenic
1201720161 Y:17088394-17088416 TTTGATTTCATTTTATTTCATGG - Intergenic
1201757332 Y:17500577-17500599 TTTCCATACATTCTAATGCAAGG + Intergenic
1201844222 Y:18405405-18405427 TTTCCATACATTCTAATGCAAGG - Intergenic
1202605683 Y:26637964-26637986 TTTGATTTCATTTTTATGTATGG - Intergenic