ID: 991273260

View in Genome Browser
Species Human (GRCh38)
Location 5:64812053-64812075
Sequence CTCTTACTGTACTTTGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 149}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991273260 Original CRISPR CTCTTACTGTACTTTGTGTC TGG Intronic
902328527 1:15718572-15718594 CTCTTCCTGACCTTGGTGTCCGG + Exonic
902417379 1:16248611-16248633 CTATTGCTGTACCTTGTGTTAGG - Exonic
904257160 1:29261054-29261076 CTAATACTTTACTTTGTGTCAGG + Intronic
906898291 1:49804313-49804335 GTCTTAGTGTATTTTGTGTGTGG + Intronic
907085049 1:51664353-51664375 CACTTATTTTCCTTTGTGTCTGG - Intronic
908929654 1:69303538-69303560 TTCTTGCTGTACTCTGTGTGGGG + Intergenic
909918431 1:81349796-81349818 CTATTTCTGTACTTTGCCTCTGG + Intronic
911383696 1:97147824-97147846 CTTTTACTGTACTTTGAGAATGG + Intronic
911386067 1:97177011-97177033 CTCCTACTAGACTTTGTTTCAGG + Intronic
912242911 1:107929624-107929646 ATCTTATTGTACTGTCTGTCTGG - Intronic
912336605 1:108868595-108868617 CTCTTAATTTACATGGTGTCAGG - Intronic
914408203 1:147398427-147398449 CTCCTGCTGTACTTTTTTTCAGG + Intergenic
917134153 1:171772551-171772573 CTCTTGCTGTCCTTTCTGCCTGG - Intergenic
917468353 1:175304682-175304704 CACTTGCTGTTCTTTCTGTCTGG + Intergenic
918477785 1:184944004-184944026 CTGTTGCTGTACAATGTGTCAGG - Intronic
1063280619 10:4625642-4625664 CTGTCACTGTACTTTGGGGCAGG - Intergenic
1063571843 10:7222582-7222604 CTCTTACTGCTGTTTGTGTTAGG - Intronic
1065318353 10:24486033-24486055 ATCTTACTGTTCTCTGGGTCTGG - Intronic
1067271285 10:44793478-44793500 CTCATACAGTACTTTGTGTGTGG + Intergenic
1070224752 10:74491277-74491299 ATTTTACTTTACTTTGAGTCAGG + Intronic
1071806232 10:89124098-89124120 ATTTTTCTGTCCTTTGTGTCTGG - Intergenic
1073195861 10:101691200-101691222 CTCTTGCTGTACTTTGGGCCCGG + Intronic
1073687337 10:105769756-105769778 CTCCTACTGGATTTTCTGTCGGG - Intergenic
1075351392 10:121727891-121727913 CTCTTATGGTAATTTGTATCTGG - Intergenic
1077382261 11:2249692-2249714 CTCTTGGTGTTCTTTGTGTGGGG + Intergenic
1078887813 11:15522820-15522842 CACTTACTGTTCTTTCTGTCTGG + Intergenic
1081155602 11:39685755-39685777 CTTTTATTCTACTTTTTGTCAGG + Intergenic
1081557239 11:44176193-44176215 CTATTGCTGTACTTTCTGTCTGG - Intronic
1081926413 11:46833095-46833117 CTCTTATTGTACTTTGCCTCAGG - Intronic
1083669756 11:64293055-64293077 GTCTTGCTTTACTTGGTGTCTGG + Exonic
1090265933 11:125352931-125352953 CTCCTTCTGAACTTTGTCTCGGG - Intronic
1101203225 12:102458748-102458770 CTCTTACAGCACTTTGTTTTTGG - Intronic
1102263783 12:111463674-111463696 CTATTTCTGTACTTTTTGCCAGG + Intronic
1106633308 13:31500251-31500273 CTCTTTCTGCACTTTTTGTAGGG - Intergenic
1108206256 13:48093482-48093504 CTCTGAATGTAATTTGTGTCTGG - Intronic
1108892894 13:55283626-55283648 CTCTTAGTGTGCTTTGTGTAGGG + Intergenic
1109469788 13:62790271-62790293 CTCTTTCTGCATTGTGTGTCGGG - Intergenic
1109558526 13:64015021-64015043 CTCTCACTGTACTTTTTGCATGG - Intergenic
1110807886 13:79779232-79779254 CTCTGACTGTACTTCATTTCAGG - Intergenic
1114922892 14:27357271-27357293 CTCTTAAAGTACTTTGATTCAGG - Intergenic
1118471831 14:66081626-66081648 CTCCTACTGTTCTCTGTGTGAGG - Intergenic
1118807051 14:69247041-69247063 CTCTTTCTGTGTTTTGTGTGTGG + Intergenic
1120430487 14:84407834-84407856 CTGTTATTGTACTTTTTGTCAGG + Intergenic
1120744161 14:88138948-88138970 CTCTTAGTATCCTGTGTGTCTGG - Intergenic
1123207484 14:106727398-106727420 CTCCTGCTGTATTTTGTGTGTGG - Intergenic
1124174884 15:27415347-27415369 CTCTGACAGTGCTTTGGGTCTGG + Intronic
1124226408 15:27898530-27898552 GACTTACAGTTCTTTGTGTCTGG - Intronic
1125709964 15:41776768-41776790 TTCTTACTGTAATTTTGGTCTGG + Intronic
1125873562 15:43124232-43124254 CCTTTACTGTAGTTTGTTTCTGG + Intronic
1126553611 15:49961331-49961353 CTCTTACACTTGTTTGTGTCAGG + Intronic
1127026180 15:54809429-54809451 CTATTACTGTACTTTTTATCTGG + Intergenic
1129749140 15:78048271-78048293 CTGTTACTGTTATTTTTGTCTGG + Intronic
1130458681 15:84141143-84141165 CACATACTGTAGTTTGTTTCTGG + Intergenic
1131686142 15:94769944-94769966 CTCTTAATGTTCTATGTGTTTGG - Intergenic
1131768571 15:95708685-95708707 CTGTTAGTGTATTTTGTGTGTGG + Intergenic
1131823886 15:96300919-96300941 TACTTAATGTATTTTGTGTCAGG + Intergenic
1135772918 16:25230819-25230841 CTTTTACTTTATTTTGTGGCAGG - Intergenic
1137513001 16:49117659-49117681 CTGCTACTGTCCTTGGTGTCTGG - Intergenic
1140351041 16:74262242-74262264 CTCTGAGTGTACTTTGTGATGGG - Intergenic
1140805569 16:78529350-78529372 CTCTTACTGAATTATGTGGCTGG + Intronic
1150602585 17:66663599-66663621 CTCTCACTGTGTTTTGTCTCTGG + Intronic
1150859000 17:68781410-68781432 CACTTACTGTTCTCTGTGTGTGG + Intergenic
1152016754 17:77755995-77756017 CTCTGACTGTCCTTCGTGCCAGG - Intergenic
1153648329 18:7215481-7215503 CTATTACTTTACTATGTGTCAGG + Intergenic
1153918842 18:9770648-9770670 GTTTTACTGTACTTTATTTCAGG + Intronic
1154258228 18:12804570-12804592 CTCTTACAATACTTTGTTTATGG - Intronic
1155560364 18:27069811-27069833 CTTTTGCTGTAATTTGTGTCTGG - Intronic
1156762285 18:40607388-40607410 CTCTTTCTATATATTGTGTCAGG + Intergenic
1158067737 18:53433330-53433352 CTCTCCCTGTAATTTGTGGCAGG - Intronic
1161147122 19:2685617-2685639 CCCTTACTTTACTTTGAGACAGG - Intronic
1161559600 19:4965151-4965173 ATTATACTGTATTTTGTGTCTGG + Intergenic
1165822719 19:38686699-38686721 CTCTTCCTGGACTCTGTGTGGGG + Intronic
1166563699 19:43750307-43750329 CGCTTGCTGTTCTTTCTGTCTGG + Intronic
1168662424 19:58178186-58178208 CTCTTGCTGTCCTTAGTGTGGGG - Intergenic
925161513 2:1687343-1687365 ATATTACTGTCCTTGGTGTCAGG + Intronic
926868244 2:17383805-17383827 TTCTTAGTGTTCTTTGTTTCTGG - Intergenic
928447805 2:31348383-31348405 ATTTTACTGAATTTTGTGTCTGG - Intronic
932554638 2:72810880-72810902 CACTTTTTGTACTTTTTGTCAGG - Intronic
933154306 2:78954944-78954966 CTTTTACTGTGCTTTGTAACTGG - Intergenic
933573096 2:84036409-84036431 ATCTTTATTTACTTTGTGTCAGG + Intergenic
941022577 2:160424412-160424434 CTCTTACTGTCTGTTTTGTCTGG + Intronic
942786815 2:179709986-179710008 CCATTCCTGCACTTTGTGTCTGG - Intronic
944096940 2:195978193-195978215 ATCTTACTGTACTATCTGTCTGG - Intronic
944115730 2:196184386-196184408 CACTTACCATACTTTGTGCCAGG - Intergenic
945221724 2:207490446-207490468 CTCTTACTGCACATTGTGAAGGG + Intergenic
947236244 2:227944158-227944180 CTCTCACTCTACTTGGTCTCAGG - Intergenic
1170033728 20:11968834-11968856 CTCTTGCTGTTCTCTCTGTCTGG - Intergenic
1172424629 20:34846908-34846930 CACTTACTGTTCTTTCTGCCTGG + Intronic
1176361644 21:6001744-6001766 CTCTATCTCTACTTTGTTTCCGG - Intergenic
1176939052 21:14901714-14901736 GTCTTACTGTACTTTGCTTCTGG + Intergenic
1177515083 21:22138813-22138835 CTTTTACTGTCCTTTGTAACTGG - Intergenic
1177566878 21:22834946-22834968 CTCTTCTTGTAGTTTTTGTCTGG - Intergenic
1179761874 21:43536806-43536828 CTCTATCTCTACTTTGTTTCCGG + Intronic
1180820141 22:18821490-18821512 CTCCGACAGTCCTTTGTGTCTGG + Intergenic
1181206364 22:21255962-21255984 CTCCGACAGTCCTTTGTGTCTGG + Intergenic
1181528726 22:23504000-23504022 CTCTGACTGCACTGTGTGTGTGG - Intergenic
1182637360 22:31738911-31738933 CCCTTCCTGTGATTTGTGTCAGG - Exonic
1203220556 22_KI270731v1_random:39461-39483 CTCCGACAGTCCTTTGTGTCTGG - Intergenic
1203270268 22_KI270734v1_random:47361-47383 CTCCGACAGTCCTTTGTGTCTGG + Intergenic
950428707 3:12938682-12938704 CCCTCACTGTACTTTGTGGGCGG + Intronic
956663629 3:71622126-71622148 CTTTTACTGTGCTAAGTGTCTGG - Intergenic
958513783 3:95085349-95085371 CTCTTTTCTTACTTTGTGTCTGG + Intergenic
959672796 3:108997964-108997986 CTATAACTGTACTTTTTTTCAGG - Intronic
960884794 3:122383290-122383312 CTCGTACTATATTTTTTGTCAGG - Intergenic
961122871 3:124388076-124388098 ATCTTGCTGTACTTAGTGTGTGG - Intronic
964047670 3:152350043-152350065 TTCTTACTGTACATTCTCTCTGG - Intronic
968144802 3:196288952-196288974 CTGTTAGTGTACTTTATGTGTGG - Intronic
970911040 4:21275913-21275935 CTGTTAGTGTATTTTATGTCTGG - Intronic
971860177 4:32091428-32091450 ATCTTTCTGTACTTTCTCTCTGG - Intergenic
974195008 4:58562618-58562640 CTGTTACTGTAATTCTTGTCTGG - Intergenic
976104375 4:81601165-81601187 GTGTTTCTGTACTTTGTGTTTGG - Intronic
977839012 4:101678389-101678411 CTCTGAGTCTACTCTGTGTCCGG + Intronic
984846220 4:184110177-184110199 TTCTTTCTGTTCTTTGTTTCGGG + Intronic
985480339 5:106592-106614 CTCTAACTGAAATTTGTTTCAGG - Intergenic
985983789 5:3495731-3495753 CACTTACTTTAGTTTGTTTCAGG + Intergenic
988697636 5:33639405-33639427 CTCTCATTGTACTTTCAGTCTGG - Intronic
991273260 5:64812053-64812075 CTCTTACTGTACTTTGTGTCTGG + Intronic
992188998 5:74272391-74272413 CTCTTACTGTACTCTTTTCCTGG + Intergenic
992321349 5:75616053-75616075 CTCTTACGGTCCTTTCTGTTTGG + Intronic
992332496 5:75731557-75731579 CTCTTAGTGCACTCTGTGTGTGG - Intergenic
993055035 5:82971382-82971404 CACTTAGTGAACTTTGTGTTGGG + Intergenic
995359559 5:111279558-111279580 CAATTATTCTACTTTGTGTCAGG + Intronic
996816835 5:127583589-127583611 CTCTTACTGTTCCTTTTGCCTGG + Intergenic
997596131 5:135108470-135108492 CTCTTACTGCACCTTGTTTTTGG + Intronic
999300845 5:150489421-150489443 CTGTTCCTGTGCCTTGTGTCAGG + Intronic
999318559 5:150599676-150599698 CTCTTTCTGTACTGTGAGCCTGG + Intergenic
1006489258 6:34372507-34372529 TTTTAAGTGTACTTTGTGTCAGG + Intronic
1007887451 6:45247051-45247073 CTCTTCTTGTACTTTGTGCTTGG - Intronic
1010158635 6:72825338-72825360 TACTTACTGTACTTGTTGTCTGG + Intronic
1011368928 6:86611526-86611548 CTCTTTCAGGACTTTGTGTAAGG - Intergenic
1012239091 6:96851788-96851810 GTCTTACTCTTCTTTGTATCTGG + Intergenic
1013629415 6:111971557-111971579 ATCTTACTCTCCTTTGTGTTAGG - Intergenic
1017491032 6:154945282-154945304 CTCTTGCTGTCCTTTCTGTCTGG + Intronic
1017870350 6:158481462-158481484 CTCTAAATGTACTTTTTGACAGG + Intronic
1018116512 6:160590986-160591008 CTGTCACTGGACATTGTGTCAGG + Exonic
1021205310 7:17772870-17772892 CTCCTAATTTAATTTGTGTCGGG - Intergenic
1021568003 7:22033185-22033207 CTCTGACTTTAGTTTGTGTTTGG - Intergenic
1026324511 7:69297274-69297296 TTTGGACTGTACTTTGTGTCAGG - Intergenic
1027846914 7:83391385-83391407 CAATTACTGTACTATGTGCCAGG - Intronic
1027906143 7:84184980-84185002 CTCTCCCTTTGCTTTGTGTCAGG - Intronic
1028245108 7:88467922-88467944 CTTTTACAGGACTGTGTGTCTGG + Intergenic
1030200001 7:106892851-106892873 CTCGTGCTGTTCTTTCTGTCTGG - Intronic
1031681289 7:124678126-124678148 CTTTTTCTGTTCTTTGTCTCAGG - Intergenic
1033445365 7:141416820-141416842 CTCGTTATGTACTCTGTGTCTGG - Intronic
1038442439 8:27581275-27581297 CTCTTATTGTACATGGTGTGAGG + Intergenic
1038977156 8:32712508-32712530 CTCTTATTGTAAATTATGTCTGG + Intronic
1039548698 8:38428306-38428328 ATCTTACTGCCCTTTGGGTCTGG - Intronic
1041031034 8:53735414-53735436 CTTTTTCTGAACTTTGTGGCTGG - Intronic
1042283883 8:67085924-67085946 TTCTTACTGTGCTTTGTTACAGG + Intronic
1043471964 8:80572058-80572080 CTCCTACTGAGGTTTGTGTCTGG - Intergenic
1043953319 8:86334036-86334058 CTCTGATTGTACTTTGTCTTCGG + Intergenic
1051971639 9:22894907-22894929 CACATACTGTTCTTTGTGTTAGG - Intergenic
1052853719 9:33393976-33393998 CTCTTTCTGTACACTGTCTCTGG + Intronic
1059331342 9:113537556-113537578 ATATAACTGTACTTTGTGGCTGG - Intronic
1061074981 9:128335695-128335717 TTCTAACTGTACTATATGTCAGG + Intergenic
1061255388 9:129452154-129452176 CTCTGACTGCACTGTGTGTGTGG + Intergenic
1061549623 9:131325866-131325888 TTCTTACTGTGCTTTGTGCAGGG - Intergenic
1061576284 9:131508691-131508713 CTCTTTCTTTTCTTTGAGTCAGG - Intronic
1186381259 X:9062348-9062370 CTGTGACTGTAGTTTGTGTCTGG - Intronic
1187851900 X:23599292-23599314 TTCTTATTGTACTTTCTGGCAGG - Intergenic
1188000712 X:24978093-24978115 CCCTTACTGTAATTTGAGTGAGG + Intronic
1188732903 X:33673941-33673963 ATCATACTTTCCTTTGTGTCGGG - Intergenic
1189590134 X:42502137-42502159 CTCTCACTGTACTTTGCCACTGG + Intergenic
1192137449 X:68616905-68616927 GTGTTACTGTATTTTGTGTGTGG - Intergenic
1193530693 X:82650717-82650739 CTCTCACTTTACCTTTTGTCAGG - Intergenic
1197487378 X:127070130-127070152 CTCTTTCTATAGTTTTTGTCTGG + Intergenic