ID: 991277411

View in Genome Browser
Species Human (GRCh38)
Location 5:64865626-64865648
Sequence CCTTATTTTTAGAGGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 1, 2: 0, 3: 64, 4: 306}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991277411 Original CRISPR CCTTATTTTTAGAGGGAAGA TGG Intronic
901122277 1:6905549-6905571 CTTTATTATGAGAGGGAAGCGGG - Intronic
902933282 1:19746152-19746174 CCTCATGTTTGGAGGGAACATGG - Intronic
903003603 1:20283847-20283869 TCTTATCTTTAGAGTGGAGATGG - Intergenic
904321389 1:29699612-29699634 CCTTATCCTTAGAGCAAAGAGGG - Intergenic
906268402 1:44453488-44453510 CCTGATTTTAAGAGGCAAGCAGG - Intronic
907847146 1:58219270-58219292 GCATATTTTTAAAGGAAAGAAGG + Intronic
908834469 1:68214655-68214677 ACTTATTTTTAAACTGAAGAAGG + Intronic
910298679 1:85680204-85680226 CTTTATTTTTGGAGGGGAGTGGG - Intronic
910498369 1:87859552-87859574 CCTTAATTTTAGAAGAATGATGG + Intergenic
911253230 1:95604241-95604263 TCTTATTTTATGATGGAAGATGG + Intergenic
911704556 1:100996361-100996383 TCTGATTTTTAAAAGGAAGAGGG + Intronic
913219277 1:116646313-116646335 CGTTATTTTTAGGAGGAAGATGG + Intronic
914044594 1:144080050-144080072 CCTGAATTTTAAAGGGAAGAGGG - Intergenic
914133516 1:144880636-144880658 CCTGAATTTTAAAGGGAAGAGGG + Intergenic
915168410 1:153961674-153961696 CCTCAGTTTTAGAGGAAAAAAGG + Intronic
916455187 1:164963779-164963801 ACTTATTTTAAGAAGGAATAAGG + Intergenic
917719286 1:177770815-177770837 CCTTCTTTTTGGAGGGTAGAGGG + Intergenic
918294483 1:183143279-183143301 CCTTTTGCTTAGAAGGAAGAGGG - Exonic
919025130 1:192158619-192158641 TCTTCATTTTAGAGAGAAGATGG + Exonic
922486458 1:225976868-225976890 GCTTATTTTCTGAGGGGAGAGGG + Intergenic
923251885 1:232185498-232185520 CCTTATTTTTAGGGACAACAGGG - Intergenic
923690083 1:236184062-236184084 CCTTATCTTTTGAGGGAAAATGG + Intronic
923794761 1:237142995-237143017 CCTTCTTTTTTCAAGGAAGAAGG - Intronic
924004383 1:239591841-239591863 GTTTATTTTTATAAGGAAGAAGG + Intronic
924951174 1:248884979-248885001 CCTTAAATTTAAAAGGAAGAGGG + Intergenic
1062885486 10:1012986-1013008 TCTTTTTTTTAGGGGGGAGATGG + Intronic
1063249300 10:4256156-4256178 CCTCTATTTTAGAGGGAAGCAGG + Intergenic
1063959952 10:11298974-11298996 CCTAATTTTTAAAGGAAAGGTGG - Intronic
1064785626 10:18891377-18891399 CCTTAATTCTAATGGGAAGAAGG + Intergenic
1064974714 10:21101443-21101465 CCTTCTTGTTAGAGGGAAAGTGG + Intronic
1065245486 10:23752038-23752060 CCCTCATGTTAGAGGGAAGATGG + Intronic
1065577423 10:27136153-27136175 CCTTATTATTAGTGGAAAGAAGG + Intronic
1066244749 10:33571537-33571559 TCTTATTTTTAAAGGGGAAAGGG + Intergenic
1066495385 10:35937400-35937422 TCTGAATTTTATAGGGAAGAAGG - Intergenic
1066646963 10:37619845-37619867 CCTGAATTTTATAGGGAAGAAGG + Intergenic
1066714126 10:38268045-38268067 ACATATTTTTAGAGGAAAAAGGG - Intergenic
1066956721 10:42179737-42179759 CCTGAATTTTAAAGGGAAGAGGG - Intergenic
1068701694 10:60026666-60026688 CCTTATTTACAGAGGAAAGGAGG + Exonic
1069780356 10:70951552-70951574 CCTTATTTATGGAGGGCAGAGGG - Intergenic
1070207114 10:74274956-74274978 CCTTTTTTTTATAGGGAAGTGGG + Intronic
1071307245 10:84310259-84310281 CCTTGTTTTTAAAGAGATGAGGG - Intergenic
1071560382 10:86642283-86642305 ACTCAGTTTTAGATGGAAGATGG + Intergenic
1073756792 10:106589376-106589398 CCTTATATTTGGTGGGGAGAAGG - Intronic
1073857655 10:107696142-107696164 CCTTATTTACAGAGAGAAGAGGG + Intergenic
1073995660 10:109313196-109313218 TCTTAGTTCCAGAGGGAAGAAGG - Intergenic
1074512075 10:114122650-114122672 CCATATATTCAGAGGGCAGAAGG + Exonic
1075303062 10:121342499-121342521 CATAATTTTGAGATGGAAGAGGG + Intergenic
1077964513 11:7114350-7114372 CCTTTTTTTTAGAGAGAGGGGGG - Intergenic
1078770360 11:14344446-14344468 CCTTAATTTTAGAGGCAAAAAGG + Intronic
1080337576 11:31215836-31215858 GCTTCTTTTTAGAAGGAAAAAGG - Intronic
1080454642 11:32407196-32407218 ACGTGTTTTTAGCGGGAAGAGGG - Intronic
1080586027 11:33683354-33683376 CTTTTTTTTTAGAAGGAAGATGG - Intergenic
1080945315 11:36966346-36966368 CTTTATTTTGCGATGGAAGAGGG - Intergenic
1081008674 11:37780898-37780920 ACTCATTTTAAGAAGGAAGAAGG + Intergenic
1081999436 11:47385521-47385543 TGTTATTTCTAGAGGGAAGTAGG - Intergenic
1083242327 11:61398073-61398095 ACTTTTTTCTAGAGGGAGGAAGG + Intronic
1084034970 11:66504134-66504156 CCTTTTTTTTAGAGACGAGACGG + Intronic
1085161247 11:74348086-74348108 CGTTATTATCAGATGGAAGAAGG - Intronic
1085192720 11:74642312-74642334 CCTTCTTTTTAAAAGGAAAAAGG + Exonic
1085703328 11:78764225-78764247 CCTTATTTGTAAAGGTGAGAAGG - Intronic
1089883128 11:121794296-121794318 CGTTATGTTTTGATGGAAGACGG + Intergenic
1091538769 12:1439810-1439832 CCTAATCTCAAGAGGGAAGAGGG - Intronic
1092736310 12:11586148-11586170 CCTTGTTTTTAGAGGGAGATGGG + Intergenic
1093604741 12:21076211-21076233 CCCTATATTCATAGGGAAGAAGG - Intronic
1093912687 12:24765109-24765131 GCATATATTTAGATGGAAGATGG + Intergenic
1094443206 12:30502084-30502106 CCTCCTTTTTAGGGGGAAGGAGG - Intergenic
1096539528 12:52297378-52297400 TCTTAATTTTGGAGGGAAGGAGG - Intronic
1097462555 12:59880333-59880355 TATTATTTTTAAAGGAAAGAGGG - Intergenic
1097872734 12:64614635-64614657 CCTTATTTGCAAAGGGAATATGG - Intronic
1098373969 12:69792292-69792314 CCTTTTTTTTGGAGGGGAGGTGG - Intronic
1099193735 12:79590042-79590064 ACATATTTTGAGATGGAAGAAGG + Exonic
1099535864 12:83843884-83843906 CCTGATTTTTTCAGAGAAGATGG - Intergenic
1099884078 12:88505374-88505396 TCTTATTACTATAGGGAAGAGGG + Intronic
1100011066 12:89953856-89953878 ACTTATTTTCAGTGGGATGAAGG - Intergenic
1101462458 12:104910631-104910653 CCTGAATTTTAAAGGGAAGAGGG - Intronic
1101505798 12:105345080-105345102 CCTGAATTTCAAAGGGAAGAGGG - Intronic
1102757176 12:115351232-115351254 CCTTATTCTTAAAGGGAGGATGG - Intergenic
1103869904 12:124084030-124084052 TCTTTTTTTTAGGGGGAGGACGG + Intronic
1104063127 12:125284873-125284895 CTTTATTTTCAGAGATAAGAAGG + Intronic
1106583062 13:31034125-31034147 CCTGGTGTTTAGAGGGCAGAAGG - Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1106882720 13:34149374-34149396 CTTAATTTCTAGAGGGAAAATGG + Intergenic
1107893512 13:44935331-44935353 CCTTACTTTTACAGGTAACATGG - Intergenic
1108066048 13:46578616-46578638 TATTATTTTTAGAGGGGATAAGG - Intronic
1108215225 13:48177183-48177205 CCTCATGTCCAGAGGGAAGACGG + Intergenic
1108348267 13:49566827-49566849 TCTTATTTTCAGAGGAGAGAAGG - Intronic
1108772394 13:53719722-53719744 GCTTATTTTTATATGAAAGAAGG + Intergenic
1109801027 13:67379468-67379490 TCTTATTTTTAAAGGGAATAAGG + Intergenic
1110890204 13:80689194-80689216 ACTTATATTTAAAGGGAAGTAGG - Intergenic
1111564744 13:90000046-90000068 TCTTAGTTTTAGAGGCAACAGGG - Intergenic
1112487485 13:99833368-99833390 TCTTATTCTTAAAGGAAAGAAGG + Intronic
1113202545 13:107883071-107883093 CTGTATTTGTAGAGGGGAGAGGG - Intergenic
1114029239 14:18561362-18561384 CCTTATTGTTAGTGGAAAGAAGG - Intergenic
1118553686 14:66987856-66987878 TCTTATTTTTAAAAGGAAAAAGG + Intronic
1118996755 14:70843467-70843489 CCTTTTTATTGGAGGAAAGAAGG + Intergenic
1119984140 14:79116562-79116584 CCTTGTTTTTAAAATGAAGAAGG - Intronic
1120602989 14:86535626-86535648 CTTTATTTTTAGCAGGAAGTAGG - Intergenic
1120756455 14:88249095-88249117 CCTTTTTTTTAGTTGGAAGAAGG - Intronic
1120882273 14:89422815-89422837 GCTTACTTTAAGAGGGAAGCAGG + Intronic
1121111664 14:91317080-91317102 CCTTATTTTTAGAGGAAGAGGGG - Intronic
1121317275 14:92969781-92969803 CCTTATTTTTGGATGGGAGGTGG + Intronic
1121746776 14:96302156-96302178 TCTTATTTTTAAAGAGAAGAAGG - Intronic
1122243917 14:100387764-100387786 CCTTATTCTCAGAGGCAGGAGGG - Intronic
1202829789 14_GL000009v2_random:15061-15083 CCTTTTTTTGAGGGGGAAGCTGG + Intergenic
1202936396 14_KI270725v1_random:92023-92045 CCTGAATTTTAAAGGGAAGAGGG + Intergenic
1126884411 15:53134266-53134288 CTTCATTCTTAGAGGGAAGAGGG + Intergenic
1126952533 15:53897450-53897472 CCTTGTTTTTGTAGGGATGAGGG + Intergenic
1127262782 15:57338095-57338117 CCATATTTTTAGCAGGAACATGG - Intergenic
1127638476 15:60893365-60893387 CCTGGTTTTCTGAGGGAAGAGGG + Intronic
1127654031 15:61038948-61038970 CCTTCCTTTTTGAGGCAAGAGGG + Intronic
1129523160 15:76198392-76198414 GCTTATTCTTAGATGGAAGGTGG + Intronic
1130521222 15:84662028-84662050 CTTTACTTTCAGAGTGAAGAAGG + Intergenic
1130763492 15:86845953-86845975 CTTTCTTTCAAGAGGGAAGAAGG - Intronic
1130832994 15:87620792-87620814 CCCTATTTTGAGAGGGAGAAAGG + Intergenic
1131489997 15:92854390-92854412 CCTTATTTTTTGAGGAAATGTGG + Intergenic
1131850250 15:96534846-96534868 CTATATTTTTAAAGGCAAGAGGG - Intergenic
1131902533 15:97104035-97104057 GGTTATATGTAGAGGGAAGATGG + Intergenic
1132186223 15:99804173-99804195 CCTTCATTTTAGAGGGGGGAGGG + Intergenic
1132429450 15:101748533-101748555 CCTTCATTTTAGAGGGGGGAGGG - Intergenic
1132973088 16:2698421-2698443 CCTTGGTTTTATTGGGAAGAGGG + Intronic
1133254986 16:4511273-4511295 CCTTCTTTTTTGAGGGAAAGAGG - Exonic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1133561266 16:6952637-6952659 TCTTTTTTTTGGAGGGAGGAGGG - Intronic
1133834607 16:9356000-9356022 ATTTTTTTTTAGGGGGAAGAAGG + Intergenic
1134387200 16:13784426-13784448 GCTTATTTTAAGCAGGAAGAAGG + Intergenic
1140913549 16:79474753-79474775 CCTACTTTTTGGAGGCAAGAAGG + Intergenic
1142819185 17:2451189-2451211 CTTTATTTTCAAAGGGAAAAAGG - Intronic
1143790676 17:9292887-9292909 CCTTGTGTTTGGAGAGAAGATGG - Intronic
1144669746 17:17126301-17126323 GGTTATTTTTAGAGGCAAGGAGG - Intronic
1146002159 17:29137894-29137916 GCTTATTTTTATTGTGAAGATGG + Intronic
1147571435 17:41573458-41573480 GAGTATTCTTAGAGGGAAGAAGG - Intergenic
1147657758 17:42100342-42100364 CCTAATTTTTGGGGGGTAGAGGG - Intergenic
1148482990 17:47972134-47972156 CCTTGATTTTAGGAGGAAGAGGG + Intronic
1149028327 17:52055845-52055867 CCTTATTCTTAGAGATATGATGG - Intronic
1149458340 17:56807635-56807657 GTTTGTGTTTAGAGGGAAGAAGG - Intronic
1151005742 17:70433883-70433905 ACTGATTTTTAAAGGGCAGAAGG - Intergenic
1151137194 17:71958197-71958219 CCTTTTTTTTAGTAGAAAGATGG - Intergenic
1151998753 17:77631376-77631398 CTTTATATTAAGAGGGAAAAAGG + Intergenic
1153196505 18:2604147-2604169 CTTCATTTTAAGTGGGAAGATGG + Intronic
1153598083 18:6749475-6749497 CCTTATTTTTCAAATGAAGAAGG + Intronic
1153791044 18:8579802-8579824 TCTTATGTTGAGATGGAAGAGGG - Intergenic
1155377317 18:25174476-25174498 GCTTATTTTGAGAGGGCAGGTGG + Intronic
1156558683 18:38096866-38096888 CCTTAATTCTATAGGGTAGAGGG + Intergenic
1157463904 18:47928098-47928120 AGTCATTTTTAGAGGGTAGAGGG - Intronic
1158404585 18:57149896-57149918 CGTTATTTTTAAAAAGAAGAAGG - Exonic
1158510452 18:58085605-58085627 CCTTATTTATAGAAGAAAGAGGG + Intronic
1158684519 18:59600938-59600960 CCTTGCTTTCAGAGGGAAGAAGG + Intronic
1159236419 18:65679840-65679862 ACTTAATTTTAGAGGCAACAGGG - Intergenic
1163092279 19:15028865-15028887 ATTTATTTTTTGATGGAAGAAGG + Intergenic
1163653007 19:18529793-18529815 CCTTATTCTTGGGGGCAAGATGG + Intergenic
1163658069 19:18559373-18559395 AGTTATTATTAGAGGGAAGGGGG + Exonic
1164662162 19:29984465-29984487 CCTGATATTTGGAGAGAAGAAGG - Intronic
1164882321 19:31742990-31743012 CATTATTTTTAAAGGAAGGAGGG - Intergenic
1165383937 19:35499572-35499594 CCTTTTTTTGCGGGGGAAGATGG - Intronic
1166020721 19:40026463-40026485 TCTTTTTTCTAGTGGGAAGATGG + Intergenic
1202642898 1_KI270706v1_random:112724-112746 CCTTTTTTTGAGGGGGAAGCTGG - Intergenic
1202684153 1_KI270712v1_random:33469-33491 CCTGAATTTTAAAGGGAAGAGGG - Intergenic
925757312 2:7146231-7146253 CATTCTTTTTTGAGGGGAGATGG + Intergenic
926278135 2:11421496-11421518 CTTCATTTTTAAAGGGAATATGG + Intergenic
928500395 2:31887029-31887051 CCTTACTCTTTGAGGGAAGGAGG + Intronic
928581850 2:32716170-32716192 TGTTATGTTTAGAGGGAAAAAGG - Intronic
929040007 2:37735468-37735490 CTTTTTTTTTTTAGGGAAGATGG - Intronic
929195650 2:39181679-39181701 CCTTATAAGAAGAGGGAAGATGG + Intronic
929692483 2:44086423-44086445 CATTATTTTTAGAATGAAGAAGG + Intergenic
931964807 2:67521711-67521733 TCTTATTTTTCAAAGGAAGAAGG + Intergenic
932645433 2:73495545-73495567 TCTTATTTTTGAAGGGAGGAAGG + Intronic
932810551 2:74822238-74822260 TTTTTTTTTTAGAGAGAAGAAGG - Intergenic
933242457 2:79937682-79937704 CCTTTTTAATAGAGGGAACAGGG - Intronic
933866856 2:86527362-86527384 CTTTATTCATAGAGGGAAAAAGG + Intronic
933868081 2:86542713-86542735 CATTATTTTTAAAGGGAAAAAGG - Intronic
933874579 2:86606325-86606347 CCTACTTTTTTAAGGGAAGATGG - Intronic
934072432 2:88396858-88396880 TTTTATTTTTGGAGGGAGGATGG - Intergenic
934247567 2:90321383-90321405 CCTGAATTTTAAAGGGAAGAGGG + Intergenic
934261756 2:91481218-91481240 CCTGAATTTTAAAGGGAAGAGGG - Intergenic
934304797 2:91812197-91812219 CCTGAATTTTAAAGGGAAGAGGG - Intergenic
934328460 2:92040553-92040575 CCTGAATTTTAAAGGGAAGAGGG + Intergenic
934466839 2:94271068-94271090 CCTGAATTTTAAAGGGAAGAGGG + Intergenic
934739339 2:96707966-96707988 CCTTATTTTTAGTTGCAAAATGG - Intronic
935515481 2:104031556-104031578 CCTTATTTTTAAAAGCAAGCTGG - Intergenic
935602435 2:104936757-104936779 CCTTTTTTTCACAGGGCAGAAGG - Intergenic
935973546 2:108555194-108555216 CTTTATTTTTTGAGGGGGGAGGG + Intronic
936367220 2:111868857-111868879 TATTTTTTTTAGAGCGAAGACGG + Intronic
937590692 2:123610008-123610030 TTTTATTTTTAAAAGGAAGAAGG - Intergenic
937770966 2:125720780-125720802 GCTTATGTTCAGAGAGAAGATGG + Intergenic
939010300 2:136838626-136838648 CCTCATTTTGAAAGGGAGGATGG - Intronic
939623169 2:144445705-144445727 CCTCATTTTTTGGGGGAAAATGG + Intronic
942163693 2:173219757-173219779 CCTAATTTTTAAAGTGAAGTTGG - Intronic
942226180 2:173818328-173818350 GCTTATGTTTACAGAGAAGAAGG + Intergenic
942636841 2:178016629-178016651 ACTTATTTTTATAGGGATCAAGG + Intronic
942643372 2:178084779-178084801 TCATTCTTTTAGAGGGAAGAGGG - Intronic
943360918 2:186918041-186918063 CGTTTTGTTTACAGGGAAGATGG - Intergenic
944201359 2:197110834-197110856 TCTTTTTTTTAGAGTAAAGATGG - Exonic
944742701 2:202627697-202627719 GCCTATTTTTAGAGAGACGAGGG + Intergenic
946281561 2:218669712-218669734 CCTTACTCTTAGAATGAAGAGGG - Intronic
948286302 2:236788194-236788216 CCTTATTTTGACAGGGAAATTGG + Intergenic
948689384 2:239692275-239692297 CCTTATTTATTCAGGGAATAGGG - Intergenic
1168884883 20:1242167-1242189 CATAATTTTCAGAGGGGAGAAGG + Intronic
1169479388 20:5964346-5964368 TCTTAATTTTTCAGGGAAGAAGG - Intronic
1171112172 20:22494348-22494370 CCTTATATTTAGAGGGCCAAGGG - Intergenic
1171890017 20:30702927-30702949 CCTTTTTTTGAGGGGGAAGCTGG - Intergenic
1173239388 20:41280338-41280360 CAGTATTTATAGAGGGAAGAGGG + Intronic
1173362175 20:42354741-42354763 GCTTATTTTTGAAGGGAAGTTGG - Intronic
1173732010 20:45335641-45335663 CCTTTTTTTGAGAAGGAAGAAGG + Intronic
1175646264 20:60674947-60674969 CCTTATTTTTACATGAATGATGG + Intergenic
1176361641 21:6001711-6001733 CCTTATTTCTGGAGGGATGAAGG + Intergenic
1176587103 21:8597576-8597598 CCTGAATTTTAAAGGGAAGAGGG - Intergenic
1176608978 21:8859901-8859923 CCTTTTTTTGAGGGGGAAGCTGG + Intergenic
1177593272 21:23201641-23201663 CCTTATATTTAGATGAAAGGTGG + Intergenic
1179761877 21:43536839-43536861 CCTTATTTCTGGAGGGATGAAGG - Intronic
1180269932 22:10574573-10574595 CCTGAATTTTAAAGGGAAGAGGG - Intergenic
1180359068 22:11869733-11869755 CCTTTTTTTGAGGGGGAAGCTGG + Intergenic
1180453355 22:15488425-15488447 CCTTATTGTTAGTGGAAAGAAGG - Intergenic
1180587976 22:16910290-16910312 CCTGAATTTTAAAGGGAAGAGGG + Intergenic
1180820567 22:18824369-18824391 CGTTATTTTTAGGAGGAAGATGG + Intergenic
1181206791 22:21258841-21258863 CGTTATTTTTAGGAGGAAGATGG + Intergenic
1182256010 22:29039087-29039109 CCTGGTTTTTACAGTGAAGAGGG - Intronic
1182488636 22:30654842-30654864 CCCTATTTTTAGATGAAACAGGG + Intronic
1182655670 22:31887924-31887946 CATGATTTATAGGGGGAAGAAGG + Intronic
1203220133 22_KI270731v1_random:36582-36604 CGTTATTTTTAGGAGGAAGATGG - Intergenic
1203270693 22_KI270734v1_random:50244-50266 CGTTATTTTTAGGAGGAAGATGG + Intergenic
949625701 3:5864492-5864514 CCTTATTTTGATAGTGAAAATGG + Intergenic
950804436 3:15586690-15586712 TTTTATGTTTAGAGGCAAGATGG + Intronic
950932783 3:16807670-16807692 CCTTAATTTTATAGGGAGGAAGG - Intronic
951651462 3:24955684-24955706 CCTTTTTTTTAGGGGGTGGAAGG + Intergenic
951696184 3:25447846-25447868 AATTATTTTGAGAGGGAAAATGG + Intronic
953785681 3:45909499-45909521 ACTTGTTTTTAAAAGGAAGAAGG - Intronic
954188532 3:48939443-48939465 TCAAATTTTTAAAGGGAAGAAGG - Intronic
954989235 3:54825255-54825277 CCTTCTGTGTAGAAGGAAGAAGG - Intronic
957717368 3:83946091-83946113 CCTTATATAGAGAGGTAAGATGG + Intergenic
957935840 3:86941106-86941128 ACATATATTTAAAGGGAAGATGG - Exonic
958018786 3:87972745-87972767 GCTTATTTTTGGAGGGGAGGAGG - Intergenic
958094110 3:88919332-88919354 CCTGATTTTGAAAGTGAAGAAGG + Intergenic
958773563 3:98455001-98455023 CTTTATTTCTGGAGGGAACATGG - Intergenic
961674578 3:128556654-128556676 CCCAATTTTTAGAGGAAAGTAGG + Intergenic
961736977 3:129008445-129008467 ACATATTTGTAGATGGAAGAGGG + Intronic
962063547 3:131955055-131955077 CCATATGGTTACAGGGAAGATGG - Intronic
963063037 3:141240654-141240676 CCTGATTTTTGGGGGGAGGAGGG - Intronic
963474272 3:145783532-145783554 CATTAGTTTTAGAGGAAAGAAGG + Intergenic
964707926 3:159640458-159640480 CCTTATTTCTCAAGGGAAGCAGG + Intronic
964939784 3:162143802-162143824 CTTTATTTAAAGAGGGAGGAAGG - Intergenic
965408377 3:168299234-168299256 TCTAATTTTTAGAGGATAGAGGG + Intergenic
965858871 3:173123096-173123118 CGTTATTATTAGAAGGTAGAGGG + Intronic
967222850 3:187262777-187262799 CCTTATCTTTAGAAAGAAAAAGG + Intronic
967654346 3:192028596-192028618 CCTTATTTATAGAGGAAAAAAGG + Intergenic
968178789 3:196574518-196574540 CCTTATTTGTTGAGGAAACAAGG + Intronic
968312610 3:197696472-197696494 CTTTAATTTTAGATGGCAGAAGG - Intronic
969393810 4:6908182-6908204 CCTTGTTTTAAGAGGTATGAAGG + Intergenic
970755743 4:19424065-19424087 CGTTATTTTTAAAGGCCAGAAGG - Intergenic
971528116 4:27648398-27648420 CCTTATATTAAGAGGGAATTTGG - Intergenic
971728727 4:30348682-30348704 CCTGAGTTTCAAAGGGAAGACGG - Intergenic
971949892 4:33331777-33331799 CTTTATTTCAAGAGGGAAAATGG + Intergenic
974106792 4:57478656-57478678 CCTATTTTTCAGTGGGAAGATGG - Intergenic
974806781 4:66890808-66890830 CCTCTGATTTAGAGGGAAGATGG + Intergenic
974923844 4:68274156-68274178 CCTTATTTTTAGAAACAGGAAGG - Intergenic
983884805 4:172968505-172968527 CTTTTTTTGTAGAGGGAGGAGGG - Intronic
984749692 4:183260157-183260179 TTTTATTTTTAGAGAAAAGAAGG - Intronic
985003471 4:185508723-185508745 ATTTATTTATAAAGGGAAGACGG + Intronic
985261023 4:188115041-188115063 CATTATATTTTGAGAGAAGATGG - Intergenic
1202770266 4_GL000008v2_random:198619-198641 CCTTTTTTTGAGGGGGAAGCTGG - Intergenic
986151733 5:5136392-5136414 CCTAATTTTTAAAGGTAAAATGG - Intergenic
986408026 5:7446795-7446817 GCTTATTTTAAAAGGGGAGATGG + Intronic
987295284 5:16545017-16545039 CCTTATTTTGAGAGGAAAGCAGG + Intronic
988950364 5:36252165-36252187 CCTCATTCATAAAGGGAAGAGGG - Intronic
989627554 5:43444993-43445015 CCTTATTCTCTGAGGAAAGATGG - Exonic
990574517 5:57111599-57111621 ACTTTTTTTGAGGGGGAAGAGGG - Intergenic
990908477 5:60828977-60828999 CCTTATTTTTAGAGGTATACTGG + Intronic
991277411 5:64865626-64865648 CCTTATTTTTAGAGGGAAGATGG + Intronic
991553754 5:67872363-67872385 CCTTATCATTAGATGGCAGAAGG + Intergenic
992558488 5:77927360-77927382 CCTTATTGCTAAAGGAAAGAGGG - Intergenic
992628169 5:78653298-78653320 CCTTATTTGTAGAGAAAAAATGG - Intronic
995567770 5:113449612-113449634 ACTTCTTTTTTGAGGGAAGTAGG + Intronic
995591340 5:113703192-113703214 CCTTTTTCTTAGAGGGCAAAAGG - Intergenic
995832862 5:116373021-116373043 CCTTCTTTATAAAGAGAAGAAGG - Intronic
995845754 5:116492008-116492030 ACATATTTTTAGGGGAAAGATGG + Intronic
996347788 5:122506073-122506095 CCCTGTTTATGGAGGGAAGATGG - Intergenic
997601355 5:135140891-135140913 CCTTGTTTTGAGAAGGAAGCTGG + Intronic
997963606 5:138340112-138340134 CCTGATTTTTATAGGTCAGATGG + Intronic
998171961 5:139877742-139877764 CCCGAATTTTAGAGGGAAGGGGG + Intronic
998852512 5:146364433-146364455 CCTTCTTTTTGCAGGGAAGGAGG + Intergenic
998937112 5:147241040-147241062 CCTTATTTTTAGAAGGTTCATGG - Intronic
1000578064 5:163000818-163000840 TCTTTTTTTTGGAGGGAGGAAGG - Intergenic
1000638535 5:163672508-163672530 CCTGATTTTTAGGGGGAACAAGG - Intergenic
1001807302 5:174598494-174598516 CTTTATTTTCAGTGAGAAGAAGG - Intergenic
1002019105 5:176350772-176350794 CCTTATTTTGTGATGGGAGAGGG - Intronic
1002682005 5:180972876-180972898 TCTTATTTTTACATGGTAGAAGG - Intergenic
1003972259 6:11310922-11310944 CCTTATTGTTACAAGGATGAGGG - Intronic
1005384941 6:25276887-25276909 CATTATTTTGAAAAGGAAGATGG - Intergenic
1005499886 6:26420687-26420709 ATTTTTTTTTGGAGGGAAGAGGG + Intergenic
1006846914 6:37068792-37068814 CGATTTTTATAGAGGGAAGATGG - Intergenic
1007920773 6:45607598-45607620 ACATATTTTTACAGGAAAGAAGG + Intronic
1009901737 6:69815603-69815625 GCTTAATTTTCAAGGGAAGATGG + Intergenic
1010723156 6:79306798-79306820 GCTTATTTTTAGAAGAAAAAAGG - Intergenic
1011125988 6:84008394-84008416 CCTTCTGTTTTCAGGGAAGATGG + Intergenic
1011891603 6:92169328-92169350 TCTTATTTTCAGCAGGAAGAAGG - Intergenic
1013328498 6:109072482-109072504 CATGGTTTTTAGAGGGCAGAAGG - Intronic
1013889982 6:115014671-115014693 ACTTATCTTTAAAGGGAAGAGGG + Intergenic
1014009684 6:116461780-116461802 TTTTTTTTTTAAAGGGAAGAGGG - Intronic
1014290977 6:119558311-119558333 CCCTAGTTTTAGAGGGAGAAAGG + Intergenic
1014672791 6:124327914-124327936 CTTTATTTTTAAAGAGAATATGG - Intronic
1015911586 6:138173149-138173171 CCTTTTTTTTTGATGGATGAAGG + Intronic
1015988767 6:138913457-138913479 ACATATTTTTAGACTGAAGATGG - Intronic
1017271424 6:152511520-152511542 CCTGATTTTTATAGGTAAAAGGG - Intronic
1017305694 6:152915951-152915973 TCTTGTTTTTACAGGAAAGAAGG + Intergenic
1019082402 6:169443938-169443960 CATTATTTATAAAAGGAAGATGG + Intergenic
1020744877 7:12068399-12068421 CTTTAGTTGTAGAGGGAAAAGGG - Intergenic
1021165016 7:17327400-17327422 GCTTTTTTTTAGAGGGAAACAGG - Intronic
1022633594 7:32109786-32109808 TCTTTTCTTTAGAGGGAAGAGGG + Intronic
1022806827 7:33830893-33830915 CCCCATTTTTATAGGGATGAGGG + Intergenic
1022857336 7:34328221-34328243 CCATATTTGTAGACGGATGATGG + Intergenic
1024544899 7:50508924-50508946 CTTTCTTGTTGGAGGGAAGAGGG - Intronic
1026043097 7:66885386-66885408 CCTCAGTTTTTGAGGGACGAGGG - Intergenic
1026109984 7:67451302-67451324 CCGTATTTCTAGAGGCCAGAGGG + Intergenic
1026358794 7:69583751-69583773 CCTTATTATTAGAGCGAAAAAGG + Intergenic
1027547512 7:79546860-79546882 CAATATTTTTAGAGGAGAGATGG + Intergenic
1028464355 7:91133667-91133689 CCTTACTTTAACAGAGAAGATGG + Intronic
1030165073 7:106546134-106546156 CCTTATTTTTAAAGAGAATTAGG + Intergenic
1030185749 7:106760058-106760080 CCTTTTATTTAGAAGGAAAATGG - Intergenic
1031756658 7:125652224-125652246 CCTTATTTGAATAGGGAAAAGGG + Intergenic
1032957965 7:136994840-136994862 GCTTAGTTTAATAGGGAAGAGGG + Intronic
1036599516 8:10247523-10247545 TCTTATGTTTAGAAGGAAAAAGG + Intronic
1038109540 8:24480044-24480066 CCTTTTTGTAAGAGGGAGGAAGG + Intronic
1038129897 8:24718136-24718158 CTATATTTTTAAAGGGAGGAGGG + Intergenic
1039054711 8:33526463-33526485 ACTTCTTTTTTGAGGGGAGAGGG - Intergenic
1041305124 8:56449615-56449637 CATTATTTTCAGATGGAAGATGG + Intergenic
1041360950 8:57053528-57053550 CCTTATTTTTAGTGGGAAGATGG + Intergenic
1041598594 8:59687825-59687847 CCAAATTTTTGGAGGGTAGAGGG + Intergenic
1042881549 8:73498151-73498173 CCTTATTTCTGGGGGGAAAAAGG + Intronic
1043353056 8:79384208-79384230 GCTTATTATTTGGGGGAAGATGG - Intergenic
1044197498 8:89395359-89395381 ACTTATTTTTAGGTGGTAGAAGG + Intergenic
1044215724 8:89607897-89607919 CCTTATTTCTAGAGTAAAGGAGG + Intergenic
1044641490 8:94386897-94386919 TCTTATTTTAAAAGGGAAGTAGG + Intronic
1045704285 8:104902646-104902668 CTTTATTTTTATAGGAGAGAAGG + Intronic
1048654882 8:136524591-136524613 TATTATTTTTAGAAGAAAGAGGG + Intergenic
1049178789 8:141209842-141209864 CTTGATTTTTAGGAGGAAGAGGG - Intronic
1050967714 9:11828627-11828649 ATTTATTTTTAGAGAGAAAAAGG + Intergenic
1053539759 9:38961537-38961559 CATTCTTTTTGTAGGGAAGAGGG + Intergenic
1053696888 9:40647868-40647890 CCTGAATTTTAAAGGGAAGAGGG + Intergenic
1053943285 9:43278002-43278024 CCTGAATTTTAAAGGGAAGAGGG + Intergenic
1054308140 9:63447101-63447123 CCTGAATTTTAAAGGGAAGAGGG + Intergenic
1054359083 9:64095289-64095311 CCTTTTTTTGAGGGGGAAGCTGG + Intergenic
1054406874 9:64771092-64771114 CCTGAATTTTAAAGGGAAGAGGG + Intergenic
1054440498 9:65256558-65256580 CCTGAATTTTAAAGGGAAGAGGG + Intergenic
1054489909 9:65765366-65765388 CCTGAATTTTAAAGGGAAGAGGG - Intergenic
1054626382 9:67402381-67402403 CATTCTTTTTGTAGGGAAGAGGG - Intergenic
1056299117 9:85223459-85223481 CCTGATTTTTGGTGGGAAGACGG - Intergenic
1056341775 9:85641869-85641891 TCTTATTTTTAGAAGAAACAGGG + Intronic
1056697539 9:88872505-88872527 TTTTATTTTTTGAGGGAAGGGGG + Intergenic
1060535008 9:124378862-124378884 CCTTATTTTTAACTGGAAAATGG + Intronic
1062731602 9:138113200-138113222 CCTTCTTTTGAGAGGCATGAGGG + Intronic
1202779341 9_KI270717v1_random:21527-21549 CCTGAATTTTAAAGGGAAGAGGG + Intergenic
1203704378 Un_KI270742v1:25126-25148 CCTTTTTTTGAGGGGGAAGCTGG + Intergenic
1203559622 Un_KI270744v1:40696-40718 CCTTTTTTTGAGGGGGAAGCTGG - Intergenic
1203586405 Un_KI270747v1:7907-7929 CCTGAATTTTAAAGGGAAGAGGG + Intergenic
1203617059 Un_KI270749v1:75290-75312 CCTGAATTTTAAAGGGAAGAGGG - Intergenic
1186699508 X:12074898-12074920 CAGTATTTGTAAAGGGAAGAAGG + Intergenic
1187168794 X:16830460-16830482 CCTCACTTTTAGAGGGCCGATGG + Intronic
1187975325 X:24699356-24699378 CCTTTGTGTTTGAGGGAAGATGG + Intronic
1189234423 X:39476593-39476615 CCTTATGTTTCTAGAGAAGATGG - Intergenic
1189484335 X:41417781-41417803 GATTATTTTTAGAGGAAAGATGG - Intergenic
1189703709 X:43738309-43738331 TTTTAATTTTAAAGGGAAGAAGG + Intronic
1189953453 X:46255676-46255698 CCTTATTTATAGAGGCCAGTTGG + Intergenic
1190076517 X:47321253-47321275 CCATACTTTTAAAGAGAAGAAGG - Intergenic
1190630613 X:52381674-52381696 ACTTGATTTTAGAGGGAAAATGG + Intergenic
1190962374 X:55265155-55265177 CCTCATAAATAGAGGGAAGAGGG + Intronic
1193240674 X:79165580-79165602 CCTTATTTTAAGAAGAAGGAAGG - Intergenic
1197323930 X:125068677-125068699 ACTTGTTTTCAGAGAGAAGAAGG + Intergenic
1197416350 X:126178564-126178586 TCTTATTTTTACTGGGTAGATGG + Intergenic
1199235095 X:145483319-145483341 GCTTAATTTTAGAGTGAAAATGG - Intergenic
1201194613 Y:11479808-11479830 CCTGAATTTTAAAGGGAAGAGGG + Intergenic
1202254761 Y:22909422-22909444 CCTTCTATTCAGAGGGATGATGG + Intergenic
1202407752 Y:24543171-24543193 CCTTCTATTCAGAGGGATGATGG + Intergenic
1202463029 Y:25126910-25126932 CCTTCTATTCAGAGGGATGATGG - Intergenic