ID: 991277424

View in Genome Browser
Species Human (GRCh38)
Location 5:64865914-64865936
Sequence CACCATATGACAGATGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 102}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991277424_991277426 1 Left 991277424 5:64865914-64865936 CCAGCCACATCTGTCATATGGTG 0: 1
1: 0
2: 1
3: 8
4: 102
Right 991277426 5:64865938-64865960 GCCTTACAAGAAAATGAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991277424 Original CRISPR CACCATATGACAGATGTGGC TGG (reversed) Intronic
904378609 1:30096678-30096700 CCCCATATGGTAGCTGTGGCTGG - Intergenic
907239576 1:53074147-53074169 CTCCATCTGGCAGATGTGTCAGG - Intronic
907533968 1:55131123-55131145 AAACAAATGACAGATCTGGCAGG + Intronic
908054624 1:60270394-60270416 CAGAATATGACAGATGTGAAAGG + Intergenic
909631681 1:77774856-77774878 CACCATCACACAGATGTGGAAGG + Intergenic
911062400 1:93759605-93759627 AACCAAATGACAAATGTTGCTGG + Intronic
915982286 1:160427806-160427828 CACCATAGGGCTGCTGTGGCTGG + Exonic
919450867 1:197771932-197771954 CACAATATGACAAAAGTGGAGGG + Intronic
1063349036 10:5337642-5337664 CCCCACATGTCAGATGGGGCTGG - Intergenic
1069565906 10:69463324-69463346 CTCCATAGGAGAGGTGTGGCAGG + Intronic
1070846463 10:79526437-79526459 CACCCTATGAGACATGGGGCAGG + Intergenic
1071250018 10:83808473-83808495 CAACATATGAAAGATGAGGCTGG + Intergenic
1075227654 10:120644230-120644252 TACCATATGAGAGATGTAGGGGG - Intergenic
1079110662 11:17603346-17603368 CACCACCTTCCAGATGTGGCAGG + Intronic
1084369769 11:68733074-68733096 CACCAGATGCCAGCTTTGGCAGG + Intronic
1084392782 11:68889698-68889720 CCCCATTTGACAGATGAGACAGG + Intergenic
1085952493 11:81349003-81349025 ACCCATATGACAGACGTGGTAGG + Intergenic
1089049807 11:115536386-115536408 GACCATATGAGAGTTGGGGCCGG - Intergenic
1090152639 11:124401936-124401958 CTCCATGTGACAGCTGTAGCTGG + Intergenic
1092230411 12:6772840-6772862 GACCATAGGAGAGATGTGGGAGG + Exonic
1099608654 12:84837322-84837344 AACCATACAACAGATGAGGCAGG + Intergenic
1099623393 12:85033472-85033494 CACAATATGAGAGATGTAGTAGG + Intronic
1103343557 12:120234517-120234539 GCCCATATCACAGATTTGGCTGG + Intronic
1104148801 12:126061953-126061975 CACCATGAGACAGATGGGGAGGG - Intergenic
1104962625 12:132495439-132495461 CACCATCTGAGAGATGGGCCAGG - Intronic
1106290255 13:28354600-28354622 CACAATATTTCAGGTGTGGCTGG + Intronic
1107448689 13:40489645-40489667 CACCATTTTACAGATGAGGAGGG + Intergenic
1108209817 13:48126654-48126676 CACAATATAAAATATGTGGCTGG - Intergenic
1114693709 14:24607812-24607834 GAGCAGATGACAGCTGTGGCAGG + Intronic
1119880467 14:78095603-78095625 CACCATATGAAACATGTTCCTGG + Intergenic
1121556390 14:94840973-94840995 TACCAAATGACAGAGGTGGAAGG - Intergenic
1129666132 15:77580356-77580378 CACCAAATGAAATAAGTGGCAGG - Intergenic
1129980368 15:79863760-79863782 GACCATATGGCATATGCGGCAGG + Intronic
1138575327 16:57903965-57903987 CCCCAGATGAGAGATGTGGTAGG - Exonic
1141216193 16:82026350-82026372 CATCATAAGCCAGATGTTGCAGG - Intergenic
1145908597 17:28529643-28529665 CACCATCTGCCAGATCTGGTGGG + Intronic
1146899728 17:36575309-36575331 CACCAAATGGCAGATGATGCTGG - Intronic
1148715198 17:49710996-49711018 CACCAAGTGAGGGATGTGGCAGG + Exonic
1152624352 17:81381451-81381473 CACCAAATGCCAGAAGAGGCGGG - Intergenic
1158076107 18:53531614-53531636 CACCATATGACATGTGGAGCTGG - Exonic
1158807245 18:60988752-60988774 CATCATATTACAGATCTGGCCGG - Intergenic
1161373489 19:3926922-3926944 CACAAGATGACAAAAGTGGCTGG + Exonic
1161976602 19:7611116-7611138 CACCAGATGACAGAAGCGGGTGG - Exonic
1164871703 19:31650953-31650975 CACAATAGGACAAATGTTGCAGG + Intergenic
1166933723 19:46318188-46318210 TTCCAAATGACATATGTGGCTGG - Intronic
925271899 2:2615882-2615904 CACCATTTCACAGATGAGGAGGG - Intergenic
925337653 2:3109508-3109530 CACGGTCTGAGAGATGTGGCAGG - Intergenic
925694028 2:6555381-6555403 CATCAGATGACAGATGTTGGAGG - Intergenic
926103686 2:10137161-10137183 CCCCATTTTACAGATATGGCCGG + Intergenic
926252271 2:11161859-11161881 AGCCATTTCACAGATGTGGCAGG - Intronic
927185477 2:20479174-20479196 GACCACATGACAGATGAGGGGGG - Intergenic
942171890 2:173297624-173297646 CACCAAATGGCAGATGATGCTGG + Intergenic
946662935 2:222020350-222020372 AAACATTTTACAGATGTGGCAGG - Intergenic
1170089122 20:12570559-12570581 CACCATGTGGCAGCTGTAGCTGG + Intergenic
1171045948 20:21809506-21809528 CAGCAGATGACAGAGGTGTCGGG - Intergenic
1172005467 20:31816298-31816320 CCCCATTTCACAGATGTGACAGG - Intergenic
1174814474 20:53674872-53674894 TAACATTTGAGAGATGTGGCCGG + Intergenic
1175838124 20:62009340-62009362 GGCCATGTGACTGATGTGGCTGG - Intronic
1182900223 22:33892131-33892153 CAACAAATGACTGATGTGGTGGG - Intronic
1184242804 22:43220330-43220352 CACCAGAGCACAGCTGTGGCTGG - Intronic
1184869587 22:47226650-47226672 CACCAAATGACTGCAGTGGCTGG - Intergenic
1184945369 22:47798862-47798884 CAGCACAGGACAGATGTAGCAGG + Intergenic
955365107 3:58304138-58304160 CTCCATGTGACAGATGAGGGAGG + Intergenic
955583642 3:60452346-60452368 CCCCATTTGACAGATGTGAAAGG + Intronic
956757810 3:72406462-72406484 CTCCATATGACACTTGTGTCAGG - Intronic
956966590 3:74468822-74468844 CTCCAGATGACAGATTTGGGAGG + Intronic
958617112 3:96509251-96509273 CACCATATGACAGTTGTCATAGG + Intergenic
958760740 3:98305191-98305213 CAAAAAATGACAGATGTGGCTGG - Intergenic
959573372 3:107909091-107909113 CACCATATAGCAGATGTGGCTGG + Intergenic
961540332 3:127595121-127595143 CAGCATAGGACAGATGTGGTTGG - Intronic
961825753 3:129598230-129598252 CAGCACTTGACAGATGGGGCTGG - Intronic
967029788 3:185595102-185595124 CCCCATTTTACAGATGAGGCAGG + Intronic
968684933 4:1951680-1951702 CTCCAGCTGACAGATGGGGCGGG - Intronic
973063627 4:45761577-45761599 CCCCACATGACAGAAATGGCAGG - Intergenic
973834334 4:54794195-54794217 ACCCATATGTCAGATGTGGTCGG + Intergenic
976420545 4:84838562-84838584 AACCACATGAGAGATGGGGCCGG + Intronic
979049912 4:115917442-115917464 TACACTATGACAAATGTGGCTGG + Intergenic
983581556 4:169314526-169314548 CACCATCTGCCAGATGTTGTTGG + Intergenic
987770042 5:22290086-22290108 CACCCTACGATAGACGTGGCTGG - Intronic
991277424 5:64865914-64865936 CACCATATGACAGATGTGGCTGG - Intronic
993440007 5:87944858-87944880 CACAGTTTGACAGATGGGGCTGG + Intergenic
994357417 5:98809515-98809537 TACCACTTGACAGCTGTGGCAGG + Intergenic
996837050 5:127804911-127804933 CAGCATTTCACAGATGAGGCTGG + Intergenic
999340260 5:150764104-150764126 CAGCATATGACAGAAGTGATGGG + Intergenic
999690629 5:154143085-154143107 CACCACATGCCAGGTGTGGTAGG - Intronic
999722344 5:154408110-154408132 CACCATATAAATGGTGTGGCTGG - Intronic
1002177771 5:177411378-177411400 CAGAATATGACAGAAGTGGCTGG + Intronic
1005983592 6:30856216-30856238 CACCATAAGAGAGAGATGGCAGG - Intergenic
1010767695 6:79795120-79795142 TACCATATGTCAGATGATGCTGG - Intergenic
1015869254 6:137759618-137759640 CACCATGTGAAAGATCAGGCAGG + Intergenic
1016891768 6:149014526-149014548 CCCCATCTGCCAGATGTGGCTGG + Intronic
1017883315 6:158577156-158577178 GACCATATGACAGATCTGTTAGG + Intronic
1019174521 6:170153499-170153521 CACCATGTGACAGGCGTGTCCGG - Intergenic
1022479036 7:30731088-30731110 CAGCTGATGAGAGATGTGGCTGG + Intronic
1023252404 7:38279238-38279260 CAAGACATGACAAATGTGGCGGG - Intergenic
1029236936 7:99128189-99128211 CATCACATGCCAGATGTGCCAGG + Intronic
1032742748 7:134755295-134755317 CAACATTTGAAATATGTGGCCGG - Intronic
1033661048 7:143402330-143402352 CAACAATTGACAGATTTGGCTGG + Intronic
1040021723 8:42746815-42746837 CACCACAGGACAGGGGTGGCAGG + Intergenic
1042654347 8:71079436-71079458 TACCGTATAACTGATGTGGCAGG - Intergenic
1044781097 8:95744303-95744325 CCCCAGAAGACAGCTGTGGCAGG - Intergenic
1045351880 8:101348886-101348908 CACCAAATGAGTGATGAGGCTGG - Intergenic
1048225858 8:132584705-132584727 GCCCATAAGAGAGATGTGGCAGG - Intronic
1048744499 8:137599150-137599172 CACCCTCTGAGAGATGGGGCTGG - Intergenic
1059976127 9:119719136-119719158 CTCCATTTGACAGATGAGGCTGG - Intergenic
1062710797 9:137974174-137974196 CACCAGGTGTGAGATGTGGCAGG - Intronic
1188073401 X:25745708-25745730 CAGCAAATGACAGTTGTGGCTGG - Intergenic
1188182035 X:27067707-27067729 CAGTATATGACAAGTGTGGCTGG + Intergenic
1191667191 X:63715632-63715654 AAACATAAGACAGATGTTGCGGG - Intronic
1191871296 X:65747816-65747838 CACCATATTATAGATGAGGAAGG + Intergenic
1195125406 X:101804226-101804248 TAAAATATGACATATGTGGCTGG + Intergenic
1198519475 X:137438302-137438324 AACCAGATGGCAGATGTGACGGG + Intergenic