ID: 991277464

View in Genome Browser
Species Human (GRCh38)
Location 5:64866467-64866489
Sequence CTCTAGTTTTTTAGGGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 226}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991277461_991277464 16 Left 991277461 5:64866428-64866450 CCTAAGGCTTAAGATGTGACAAA 0: 1
1: 0
2: 1
3: 15
4: 148
Right 991277464 5:64866467-64866489 CTCTAGTTTTTTAGGGTAGAAGG 0: 1
1: 0
2: 0
3: 23
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991277464 Original CRISPR CTCTAGTTTTTTAGGGTAGA AGG Intronic
901525751 1:9822815-9822837 CTCTGGTTTTTTAGGATTGTAGG - Intronic
905797467 1:40823727-40823749 CTCTGGATTTTAAGGGGAGATGG - Intronic
906351606 1:45065352-45065374 ATCTAGTCTTTTAGGGCAGTCGG + Intronic
906523157 1:46479050-46479072 GGCTAGTTTCTTAGGGAAGAGGG - Intergenic
907480152 1:54740173-54740195 CTGTAATTTTTTTGGGTAGTGGG - Intronic
908103623 1:60816840-60816862 CTCTAGTCCTTTAGGTAAGATGG + Intergenic
908321301 1:62981619-62981641 CTCTATTTTTGTAGTATAGAAGG - Intergenic
908663203 1:66460937-66460959 CTTTTGTTCCTTAGGGTAGAAGG + Intergenic
910291335 1:85602971-85602993 CTGTAGTTTTGCAGGCTAGAAGG + Intergenic
912349903 1:109002024-109002046 CTCTAGTTGCTTAGGGAATAAGG + Intronic
912968479 1:114258204-114258226 CTCTCATTTTTTTGGGAAGAGGG + Intergenic
916006756 1:160668573-160668595 CTATAGTTTCTTAAGGTAGGAGG + Intergenic
916356393 1:163914221-163914243 TTCTAGTTTCTTGGGGTACATGG + Intergenic
919938605 1:202271310-202271332 CTCTAGTCCTCTAGGGTAGGGGG - Intronic
920532977 1:206717997-206718019 GTTTTGTTTTTTAGGGAAGAGGG - Intronic
920821842 1:209388924-209388946 GTCTAGGTTTTTAGGGTCAATGG - Intergenic
923151659 1:231238933-231238955 CTATTGTTCTTTAGGGAAGAGGG + Exonic
924208915 1:241744581-241744603 CTTTCGTTCTTTAGGGTAGAAGG + Intronic
924551768 1:245084664-245084686 CTCTAGCTTTGTATGGGAGAAGG - Intronic
1063284386 10:4668265-4668287 TTCTAGTTTCTTAAGGTAGAAGG + Intergenic
1066755508 10:38708211-38708233 TTCTAGTTTATTTGTGTAGAGGG - Intergenic
1067120899 10:43471344-43471366 CTCTAGGGTTTTGGGGTAGTGGG - Intronic
1069330889 10:67291653-67291675 ATCTAGGTATTTATGGTAGATGG - Intronic
1069348658 10:67499703-67499725 TTCTAGTTTATTTGTGTAGAGGG + Intronic
1070402412 10:76065280-76065302 CTCTATTTTTTTATTTTAGAGGG - Intronic
1070916181 10:80156419-80156441 CTCAAGTTGCTTAGGGTGGAAGG - Intronic
1073675446 10:105642156-105642178 CTGTTGTTTTTTAGTGTAGTTGG - Intergenic
1074513546 10:114141943-114141965 CTTTTGTTTTTTAAGGTAGAAGG + Intronic
1077209837 11:1364833-1364855 CTCTAGGTATTTTGGGTAGAAGG + Intergenic
1078212678 11:9283439-9283461 CTTTAGTTTTTTTTGGAAGATGG + Exonic
1082200656 11:49362689-49362711 ATCTAGTTTTTTGAGGGAGATGG - Intergenic
1083825038 11:65196602-65196624 TTCTAGTTTCTTAAGGTGGAAGG + Intronic
1085355543 11:75833447-75833469 CTCAAGTATTTAAGGGTAAAGGG - Intronic
1085943543 11:81237073-81237095 CATTTTTTTTTTAGGGTAGAAGG + Intergenic
1086093814 11:83030625-83030647 CTTTTGTTTTTTAGTGGAGATGG - Intronic
1086116170 11:83253284-83253306 CCCTACTTTTTTGGGGGAGAAGG + Intronic
1086535806 11:87843922-87843944 GTCTAGTTTTTTAAGTTAAAAGG - Intergenic
1087101560 11:94370279-94370301 CACTAGTTTTTTAGGATGGTTGG + Intergenic
1087615726 11:100485023-100485045 TTCTAGTTATTTATGGTAGGAGG - Intergenic
1088453650 11:110010437-110010459 TTCTAGTTGTTTATGGTAGGAGG - Intergenic
1088840833 11:113626411-113626433 CTCTAGTTCTGGAGGCTAGAAGG + Intergenic
1090029207 11:123193746-123193768 CTCTGGTGTTGTAGGCTAGAAGG + Intronic
1090925606 11:131247433-131247455 TTCTATTTTTCTAGAGTAGAAGG - Intergenic
1093237125 12:16624454-16624476 CTCTAGTTTTTCTGAGTAAAGGG + Intergenic
1095545724 12:43366869-43366891 TTCCAGTGTTTTAAGGTAGAAGG - Intronic
1095779388 12:46042423-46042445 CCGCAGTTTTTTAGGGTAGCAGG + Intergenic
1097259812 12:57712179-57712201 TTCTAGTTTCTTAAGATAGAAGG + Intronic
1099612861 12:84897018-84897040 TTGTATTTTTTTAGGGGAGAGGG - Intronic
1102445994 12:113003195-113003217 CTCAAGTTTCTGAAGGTAGATGG - Intronic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1104098001 12:125577668-125577690 CTCTAGTTCTCTAAGGTAGAAGG + Intronic
1105412319 13:20180917-20180939 GTCAAGTTATTTAGGGGAGAAGG - Intergenic
1106427774 13:29648996-29649018 TTCTAGTTTCTTAAGGTAGAAGG + Intergenic
1110459565 13:75730399-75730421 TTCTAGTTTATTTGCGTAGAGGG + Intronic
1114312791 14:21483092-21483114 GTCTAATTTTTTAGTGTACAAGG + Intronic
1115737141 14:36345205-36345227 CTTTATTTTTTTAGGGGGGAGGG - Intergenic
1115794754 14:36922226-36922248 TTCTAGTTGTTTATGGTGGAAGG - Intronic
1116166266 14:41337796-41337818 TTCTAGTTTATTTGTGTAGAGGG + Intergenic
1116819162 14:49610964-49610986 CTGAACTTTTTTAGGGGAGAGGG + Intronic
1117712438 14:58545337-58545359 CTATAACTTTTTAGGGTGGAGGG - Intronic
1118353002 14:64987341-64987363 TTCTCGTTCTTTAGGGCAGAGGG - Intronic
1118888515 14:69887405-69887427 CTCTACCTTTTTGGGGGAGAGGG + Intronic
1120034083 14:79675890-79675912 CACTATTTTTTTAGGAGAGAGGG - Intronic
1121614863 14:95306878-95306900 CTCTGGTTTCTTACTGTAGAAGG - Intronic
1127945428 15:63746094-63746116 TTCTAATTTCTTAAGGTAGAAGG + Intronic
1128036671 15:64532993-64533015 CTCTAGTTTTTTTGGGTCGGGGG + Intronic
1128671331 15:69576616-69576638 CTCTTGTTTTTTTGGGGAAAGGG + Intergenic
1128962889 15:72026520-72026542 TTCTAGTTTCTTAAGGTGGATGG - Intronic
1130894476 15:88159596-88159618 GTCTACTTCTTTAGGGCAGAGGG - Intronic
1134873951 16:17678529-17678551 CTCTAGCTTTTTAAGGTGGAAGG + Intergenic
1135148522 16:19984918-19984940 CTTTACTATTTTAGGGTACAAGG + Intergenic
1136727177 16:32368631-32368653 TTCTAGTTTATTTGTGTAGAGGG + Intergenic
1137714091 16:50587226-50587248 TTCTGATTTTGTAGGGTAGATGG + Intronic
1138694573 16:58800043-58800065 TTTTAGTTTCTTAAGGTAGAAGG + Intergenic
1202999257 16_KI270728v1_random:149117-149139 TTCTAGTTTATTTGTGTAGAGGG - Intergenic
1203130855 16_KI270728v1_random:1685527-1685549 TTCTAGTTTATTTGTGTAGAGGG - Intergenic
1147190181 17:38733869-38733891 CTGTAGTTCTTTGGGGTGGAGGG - Exonic
1148968790 17:51461490-51461512 CTCTAGTATTTTAGGATTAAAGG - Intergenic
1149808192 17:59639249-59639271 CTCTAATTGCTTAGGGGAGAAGG + Intronic
1151216070 17:72577049-72577071 CTCTAATTTATTTGGGTACAAGG + Intergenic
1155002256 18:21698749-21698771 CTCTGTATTTTTAGTGTAGATGG + Intronic
1156145990 18:34179282-34179304 TTCTAGTTTATTAAGGTGGAAGG - Intronic
1157356931 18:46944058-46944080 TTCTAGTTGTTTAGAGTAGCAGG + Intronic
1157728223 18:49981493-49981515 CTCTAGGCTTTTATGTTAGATGG + Intronic
1158896219 18:61916161-61916183 CTTTAGTTTACTAGGGAAGAAGG - Intergenic
1159078788 18:63711810-63711832 CTCTAGTTTTTTCCAGTAGAAGG + Intronic
1166105837 19:40597641-40597663 CTCTAGTTTATTGGGGCAGGGGG + Intronic
1166614695 19:44232836-44232858 TTTTAGTTTTTTAGCGGAGACGG + Intronic
927098465 2:19766930-19766952 TTCTATTTTGTTAGGGTTGATGG - Intergenic
928586351 2:32762354-32762376 GGTTAGTTTTTTAGGGTAGAAGG + Intronic
929040007 2:37735468-37735490 CTTTTTTTTTTTAGGGAAGATGG - Intronic
929156902 2:38796439-38796461 CTGTATTTTTTTAGTGGAGATGG - Intergenic
930877382 2:56234054-56234076 AGCTAGCCTTTTAGGGTAGAGGG - Intronic
931193666 2:60029261-60029283 CTCTTGTTTTTGATGGCAGAAGG - Intergenic
932383922 2:71313253-71313275 ATGTAGTTTTTTAGGCTTGATGG + Intronic
932421009 2:71601366-71601388 CTCTATTCCTTGAGGGTAGAAGG - Intronic
932935104 2:76093419-76093441 TTCTAGTTTATTTGTGTAGAGGG + Intergenic
933477472 2:82809649-82809671 CTCAAATTATTTAGGGTGGATGG + Intergenic
934879714 2:97965312-97965334 CTCTTTGTTCTTAGGGTAGATGG - Intronic
936888577 2:117342068-117342090 CTTTGGTGTTTTAGGATAGAAGG - Intergenic
937822932 2:126332233-126332255 TTCTAGTTTCTTAAGGTAGAAGG - Intergenic
937944385 2:127319130-127319152 CTCTCGTTTCTTAGGGGAAAAGG - Intronic
938644776 2:133319260-133319282 ATCTCATTTTTGAGGGTAGAGGG + Intronic
939975087 2:148708214-148708236 TTCTAGTTTATTTGTGTAGAGGG - Intronic
941135282 2:161709051-161709073 CTTTAGCTTTTTGGGGGAGAGGG + Intronic
941401979 2:165042324-165042346 TTCTAGTTTATTTGCGTAGAGGG + Intergenic
942239519 2:173946885-173946907 CTTTTTTTTTTTAAGGTAGACGG + Intronic
942523833 2:176831964-176831986 CTTCAGTTGTTTTGGGTAGAGGG - Intergenic
942835989 2:180298950-180298972 CTCTAGTTTCTTAAGGTGGAAGG + Intergenic
943774930 2:191755023-191755045 CTCTAGATTTTTAGGGATGTAGG + Intergenic
944851683 2:203726036-203726058 TTCTATTTTTTTAGTATAGACGG - Intronic
945906539 2:215600267-215600289 TTATAGCTTTTTAGAGTAGATGG - Intergenic
1169974126 20:11304300-11304322 CTTTAGGTTATTTGGGTAGATGG + Intergenic
1171153991 20:22854899-22854921 CTGTAGTTTTTTTGGTTAGTAGG - Intergenic
1171378888 20:24717509-24717531 TTCTAGTTTCTTAAGGTGGATGG + Intergenic
1172163552 20:32885055-32885077 CTCTAGTGCTCTGGGGTAGAGGG - Intronic
1172866103 20:38098852-38098874 TTATAGTTGTTTATGGTAGAGGG - Intronic
1173662480 20:44744299-44744321 TTCTAGTTCTGTAGGGTGGAGGG + Intergenic
1179373537 21:40828826-40828848 TTGTAGTTTTTTAGTATAGATGG + Intronic
1180306981 22:11136110-11136132 TTCTAGTTTATTTGTGTAGAGGG - Intergenic
1180545501 22:16498293-16498315 TTCTAGTTTATTTGTGTAGAGGG - Intergenic
1182943259 22:34298422-34298444 CTGTAGGTTTTTAGGGTGTAAGG + Intergenic
1183133401 22:35862417-35862439 CTGTAGTGTTTTAGGGAAGACGG - Intronic
1183736689 22:39648435-39648457 CTCTCGTTTTCCAGGGCAGAGGG - Intronic
1184628845 22:45759711-45759733 CTCTAGTTTTGTAGGGGATGGGG + Intronic
949603418 3:5627218-5627240 TTCTAGTTTTCTATGGTAGAAGG + Intergenic
953301088 3:41777193-41777215 TTCTAGTTTATTTGCGTAGAGGG + Intronic
954050169 3:47968670-47968692 TTCTAGTTTCTTTTGGTAGAAGG - Intronic
954258865 3:49424584-49424606 CTGGAGTGTTTTTGGGTAGAAGG + Exonic
954591289 3:51785379-51785401 TTCTAGTTTCTTTAGGTAGAAGG + Intergenic
956370111 3:68549882-68549904 ATCTAATCTTTTAGGATAGATGG + Intergenic
956418392 3:69058740-69058762 CTCTAGCTTTTTTTGGTCGAAGG - Intronic
956524775 3:70145773-70145795 TTCTAGTTTCTTAAGGTGGAAGG - Intergenic
957315178 3:78567384-78567406 CTCTAGCTCTTAAGAGTAGAAGG + Intergenic
957812072 3:85235932-85235954 CTGTAGATTATTAGGGTATATGG + Intronic
959772875 3:110120426-110120448 TTCTAGTTTATTTGCGTAGAGGG + Intergenic
960495361 3:118367249-118367271 CTCTAGTTTCTTAATGTGGAAGG + Intergenic
960774643 3:121235948-121235970 CTGTGTTTTTTTAGGGTAGGAGG - Intronic
961005294 3:123401402-123401424 CTCTCATTTTTTAAAGTAGAGGG - Intronic
961598264 3:128037103-128037125 TTCTAGTTTCTTAAGGTAGAAGG - Intergenic
962886456 3:139632423-139632445 CTCCAGTTCTGTAGGGCAGAGGG - Intronic
963480410 3:145866455-145866477 ATCTAGTATTTTTGGGGAGAAGG + Intergenic
964243730 3:154625761-154625783 CTCTAGGTTTTTAAGGTTAATGG - Intergenic
964309945 3:155381875-155381897 GTTTAGTTTTGTAGGGAAGAGGG - Intronic
964836508 3:160944506-160944528 CTCTAACTTTTTAGGTTATATGG + Intronic
966451297 3:180065701-180065723 CTATAGTTTTTTATGTCAGAAGG - Intergenic
966531566 3:180987604-180987626 CTCTAGTTAATTAGGCTATAGGG - Intronic
966778298 3:183562042-183562064 CACTACTTGTTGAGGGTAGACGG - Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
969611625 4:8230648-8230670 TTCTAGTTTCTTAAGGTGGAAGG + Intronic
971540961 4:27815821-27815843 TTCTACTGTTTGAGGGTAGAAGG - Intergenic
971783701 4:31073154-31073176 GCATAGTTTTTTGGGGTAGAAGG + Intronic
972104148 4:35461671-35461693 CTCTGGTTTTTTAAAGCAGAAGG + Intergenic
972623207 4:40769328-40769350 TTCTAGTTGTTTACAGTAGAAGG - Intronic
977268854 4:94889779-94889801 CTCTAGGTTTTTTGGGTGGGTGG + Intronic
977951149 4:102971859-102971881 TTCTAGTTTATTTGTGTAGAGGG - Intronic
979667969 4:123333426-123333448 TTCTAGTTTATTTGTGTAGAGGG + Intergenic
980755428 4:137152729-137152751 CTCTAGTTTTACATGCTAGAAGG + Intergenic
980881481 4:138714245-138714267 CTCCAGTTAATTAGGGTAGAGGG + Intergenic
981575555 4:146200906-146200928 TTCTAGTTTAGTAGTGTAGAAGG - Intergenic
982290162 4:153772896-153772918 CTCTTATTTTTTAAGGTAGAAGG + Intergenic
982357683 4:154488730-154488752 CTGTATTTTTTTAGTGGAGATGG - Intronic
982706167 4:158712049-158712071 TCCTAATTTTGTAGGGTAGATGG - Intronic
983207191 4:164922981-164923003 GTCTAGTTTCTTAAGGTAAAGGG + Intergenic
983211587 4:164964039-164964061 CTCTAGTTTCTTAAGGTAAAGGG - Intronic
984525846 4:180858617-180858639 TTCTAGTTTATTTGTGTAGAGGG + Intergenic
984579207 4:181490929-181490951 CGCTTGTTTTGGAGGGTAGAGGG - Intergenic
984599993 4:181714807-181714829 CTCTACTTTTTTTGCATAGATGG - Intergenic
985754602 5:1705796-1705818 TTCTATTTTTTTAGGGTAGGTGG + Intergenic
991277464 5:64866467-64866489 CTCTAGTTTTTTAGGGTAGAAGG + Intronic
992251502 5:74880403-74880425 TTCTAGTTTCTTAAGGTAAAAGG + Intergenic
992601863 5:78409129-78409151 CTCTAGTTTACTAGTGCAGATGG + Intronic
993751720 5:91677607-91677629 TTCTACTTTTTTAGTGGAGACGG + Intergenic
994164767 5:96597276-96597298 CTTTTCTTTTTTAGGGCAGATGG - Intronic
994314431 5:98316119-98316141 CTCTATATTTTTTAGGTAGATGG + Intergenic
994340455 5:98621326-98621348 CTCGAGTATTCGAGGGTAGATGG - Intergenic
994434604 5:99711167-99711189 TTCTAGTTTATTTGCGTAGAGGG + Intergenic
994948606 5:106428155-106428177 TTCTAGTTTATTTGCGTAGAGGG + Intergenic
997010293 5:129868822-129868844 TTCTAGTTTGTTTGTGTAGAGGG - Intergenic
997083776 5:130772092-130772114 CTCTTGTTTTTAGGGGGAGAAGG + Intergenic
1000720186 5:164696276-164696298 TTCTAGTTTATTTGCGTAGAGGG - Intergenic
1000776511 5:165426324-165426346 CACTAGCTTTTTAGGCTACAAGG + Intergenic
1000780601 5:165475349-165475371 CTCCAGTAATTTTGGGTAGATGG + Intergenic
1001174854 5:169458740-169458762 CTGTAGTTTTTCAGGGGACAGGG + Intergenic
1002677475 5:180929684-180929706 TTCTAGTTTATTTGTGTAGAGGG - Intronic
1003702402 6:8482168-8482190 TTCTAGTTATTTAAGGCAGAAGG + Intergenic
1004058161 6:12162064-12162086 TTCTTGTATTTAAGGGTAGAGGG + Intronic
1004474977 6:15962924-15962946 CTCTGGTGACTTAGGGTAGAAGG - Intergenic
1006994356 6:38244490-38244512 CTCTGGATTTTTAGAGTAAAAGG - Intronic
1008684816 6:53913803-53913825 TTCCAGTTTTCTAGGGGAGATGG - Intronic
1009512228 6:64567840-64567862 TTCTAGTTGTTTAGAGCAGAAGG - Intronic
1012634742 6:101523890-101523912 TTATAGTTTTTTAGTGGAGATGG + Intronic
1013339072 6:109195328-109195350 TTCTAGTTGTTTATGATAGAAGG + Intergenic
1016226867 6:141749245-141749267 TTCTAGTTTATTTGCGTAGAGGG - Intergenic
1016232101 6:141818049-141818071 TTCTAGTTTATTTGCGTAGAGGG - Intergenic
1016657202 6:146533855-146533877 CTCTAGTTTCTTAAGGCGGAGGG - Intergenic
1019074362 6:169375917-169375939 CTCTAGTTTTTGTGTGTAGAAGG - Intergenic
1020309382 7:6856965-6856987 CTCTTGTTGTTTAGGCTGGATGG + Intergenic
1020856841 7:13437703-13437725 TTCTAGTTTTTTAAGGTGCATGG - Intergenic
1022332921 7:29397213-29397235 GTCTACTTTTTAAGGATAGAGGG + Intronic
1028481301 7:91308814-91308836 TTCTAGTTTCTTAAGGTGGAAGG - Intergenic
1028521790 7:91740410-91740432 ATATAGTATTTTAGGGTAAAAGG + Intronic
1030345259 7:108426266-108426288 ATCTAGAGTTTTAGGGGAGAGGG - Intronic
1031863536 7:127011907-127011929 CTCAAGTTTTTTGGTGTGGAAGG - Intronic
1031947739 7:127858749-127858771 ATGTTGCTTTTTAGGGTAGAAGG - Intronic
1032748860 7:134815607-134815629 CTCATGTTTTTTAAGGTTGAAGG + Intronic
1033139346 7:138811194-138811216 TTCTATTTTTTTAGGTTGGAAGG + Intronic
1033140167 7:138819029-138819051 GTATAGTTTTTTAGTGGAGATGG - Intronic
1033193736 7:139308671-139308693 CTCTAGGTTTTTTGGGTAATAGG + Intergenic
1033669078 7:143472549-143472571 CTCTTTGTTCTTAGGGTAGATGG - Intergenic
1034403677 7:150886571-150886593 TTCTAGTGTTTTAAGGTGGAAGG - Intergenic
1037914432 8:22764269-22764291 CTCCATTTTTTCAGGATAGAGGG - Intronic
1038080587 8:24131221-24131243 CTGCATTTTTTTAGGGTAAAAGG - Intergenic
1039281224 8:35987069-35987091 TTCTAGTTTATTTGCGTAGAGGG + Intergenic
1040563287 8:48543729-48543751 CTGCAGTTTTCTAGGTTAGAAGG - Intergenic
1040968510 8:53109252-53109274 TTCTAGTTTATTTGTGTAGAAGG + Intergenic
1041877424 8:62706313-62706335 CTCCAGATTTTTAGGGGAGGAGG + Intronic
1042360103 8:67872660-67872682 CTCTAGTTTCTTGAGGTAGAAGG - Intergenic
1042368023 8:67958798-67958820 CTCTAGTTTTGAAGACTAGATGG + Intronic
1043300096 8:78717314-78717336 CTTTACTTTTTTAGGCCAGATGG + Exonic
1045785408 8:105915675-105915697 CAATAGTGTTTTAGGGTAGGGGG - Intergenic
1047032233 8:120895185-120895207 TTCTAGTTTCTTAAGGTAGAAGG + Intergenic
1048233758 8:132669723-132669745 GTATAGATTTTTAGGCTAGAGGG - Intronic
1051385231 9:16500651-16500673 ATTTAGTTTTTCAGGGTGGATGG + Intronic
1051706136 9:19882098-19882120 CTCTATTTCCTTGGGGTAGAGGG + Intergenic
1051960424 9:22754490-22754512 CTATATTCTTTTAAGGTAGATGG + Intergenic
1055605979 9:77970998-77971020 TTCTAGTTTATTTGTGTAGAGGG - Intronic
1055759774 9:79594751-79594773 CTCTTGTATTTTGGGGTAAATGG + Intronic
1055939549 9:81636606-81636628 TTCTAGATTTTTAGGGGAGTGGG - Intronic
1058191819 9:101925923-101925945 GTCCAGTTTCTTAGAGTAGAAGG + Intergenic
1060033322 9:120234102-120234124 CTCTAGTGCTTTATGGTAAAGGG - Intergenic
1060098370 9:120814174-120814196 CTCATGTTTTTGAGGCTAGAAGG + Intergenic
1189025924 X:37394387-37394409 TTCTAATTTTTAAGGGTAAAAGG - Intronic
1189175907 X:38957027-38957049 TTCTAGCTTTTTATGGTTGATGG + Intergenic
1189881297 X:45496311-45496333 ATATACTGTTTTAGGGTAGAAGG + Intergenic
1190070185 X:47273117-47273139 CTGGAGTGTTTTTGGGTAGAAGG + Intergenic
1192952438 X:76031351-76031373 CTGTATTTTTTTAGTGGAGAGGG - Intergenic
1194568976 X:95529578-95529600 TTCTAGTTTTCTAAAGTAGAAGG - Intergenic
1195602859 X:106768486-106768508 TTCTAGTTTATTTGCGTAGAGGG + Intronic
1195800901 X:108708751-108708773 TTCTAGTTTTTCAAGGTGGAAGG + Intergenic
1196014786 X:110927161-110927183 CTCTAGTTTTTTAAGATGAAGGG - Intergenic
1197646641 X:129025085-129025107 TTCTAGTTTCTTAAGGTAGAAGG - Intergenic
1198217620 X:134570255-134570277 CTCTAGTTATTGGGGGCAGAGGG + Intronic
1198632998 X:138663019-138663041 CTCTAGACTTTGAGGGTGGAGGG - Intronic
1199524617 X:148778620-148778642 TTCTAGTTTATTTGCGTAGAGGG + Intronic
1199976182 X:152896167-152896189 CCCTAGTTTGAAAGGGTAGAAGG - Intergenic
1200176756 X:154122410-154122432 CTCTAGTTATTCAGAGCAGAAGG - Intergenic
1200316260 X:155136223-155136245 TTCTGGTTTCTTAAGGTAGAAGG - Intronic
1201783955 Y:17753032-17753054 CTCTTTGTTCTTAGGGTAGATGG + Intergenic
1201817598 Y:18152955-18152977 CTCTTTGTTCTTAGGGTAGATGG - Intergenic