ID: 991280133

View in Genome Browser
Species Human (GRCh38)
Location 5:64904089-64904111
Sequence AACTGTTTGTAGAAGCATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 178}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991280133 Original CRISPR AACTGTTTGTAGAAGCATGG TGG (reversed) Intronic
900078821 1:839751-839773 ATCTGTCTGTAAAAGGATGGAGG + Intergenic
903569021 1:24290641-24290663 AAGTATTTGTGGAAGCAGGGAGG + Intergenic
906099958 1:43253885-43253907 AAATGTTTGAGGAAGCAGGGAGG + Intronic
909722955 1:78797462-78797484 AATTGTGAGTAGCAGCATGGTGG - Intergenic
910287334 1:85570229-85570251 AACTCTTTGTAGAGGCTTTGAGG - Intronic
913490931 1:119379304-119379326 AACTGTTTGTATAAACAATGTGG - Intronic
913684232 1:121216212-121216234 AAGTGTTTGTACAAAGATGGGGG + Intronic
914036072 1:144003827-144003849 AAGTGTTTGTACAAAGATGGGGG + Intergenic
914153387 1:145064118-145064140 AAGTGTTTGTACAAAGATGGGGG - Intronic
916770187 1:167900298-167900320 AACTGTATGTAGAATCAGGGGGG - Intronic
918029693 1:180793636-180793658 AACTGTTTAAAGGAGCAGGGAGG + Intronic
918148098 1:181775459-181775481 AACTCTTGGTAGCAGCATGTAGG - Intronic
919088882 1:192954229-192954251 GGCTGTTAGTAGAAGAATGGAGG + Intergenic
920471538 1:206234704-206234726 AAGTGTTTGTACAAAGATGGGGG + Intronic
921073621 1:211682783-211682805 AACTGTGGGTAAAAGCATGGAGG + Intergenic
922039845 1:221886262-221886284 GTCTGTGTGTAGAAGCATGCAGG - Intergenic
922184669 1:223263617-223263639 ATCTCTTTGGAGAAGGATGGGGG - Intronic
924095490 1:240546532-240546554 AACTCTATGTAGGAACATGGCGG - Intronic
924265476 1:242277254-242277276 AAGTGATTGTGGAAGCATTGGGG - Intronic
1062945115 10:1454725-1454747 AACTTTCTGTAGACGGATGGTGG + Intronic
1066719351 10:38321222-38321244 AAGTGATTGTGGAAGCATTGGGG + Intergenic
1068303228 10:55173347-55173369 ATGTGTATGTAGAAGGATGGGGG + Intronic
1068333089 10:55598321-55598343 AACTATTTGTGTAAGCATAGTGG - Intronic
1068370366 10:56105058-56105080 AACAGATTGCAGAAGCATGCCGG - Intergenic
1069177995 10:65318564-65318586 GAATGATTGTATAAGCATGGAGG + Intergenic
1071153555 10:82664114-82664136 AATTCCTTTTAGAAGCATGGGGG - Intronic
1072001742 10:91201946-91201968 AATTGTTAGAAGAAGCAGGGTGG + Intronic
1072028681 10:91494137-91494159 AATTGTTTGTGGAAGAAAGGAGG + Intronic
1072468779 10:95692901-95692923 AACTGTGAGTAGAAACATGTTGG - Exonic
1072544033 10:96420611-96420633 AGTCTTTTGTAGAAGCATGGTGG - Intronic
1075308771 10:121393076-121393098 AACTGTTTGCAAAAGAAGGGGGG - Intergenic
1075637599 10:124040169-124040191 AACTGGTTTTAGAGCCATGGAGG + Intronic
1077233060 11:1467123-1467145 AACAGGTGGTAGAAGGATGGAGG - Intergenic
1083302648 11:61746985-61747007 AACTGGATGTAGAAGCACGCTGG + Exonic
1084690890 11:70725823-70725845 AAATGTGTACAGAAGCATGGGGG + Intronic
1084922752 11:72484586-72484608 ATATGTTTGTAAGAGCATGGAGG + Intergenic
1086992416 11:93318495-93318517 AACTGTTAATAGAAGCCTGATGG + Intergenic
1087329119 11:96757170-96757192 AAGTGTTTGTAGAATCCTAGAGG + Intergenic
1091167902 11:133496425-133496447 AACTCTGTGAAGAAGGATGGTGG + Intronic
1096723551 12:53542601-53542623 AACTGTTTTTGTAAACATGGAGG + Intronic
1097971119 12:65634080-65634102 AACTGTTTGTACAAGCAATGTGG + Intergenic
1097971478 12:65637939-65637961 AAGTGTTTGTGGAAGGATGAAGG + Intergenic
1103379642 12:120483967-120483989 CACTGTGTTTAGCAGCATGGTGG + Intronic
1107219497 13:37965293-37965315 AACAGTTTGTGGAATGATGGAGG - Intergenic
1107929891 13:45298559-45298581 AAGTGTGTGTAGAAGCAGGTGGG - Intergenic
1108193163 13:47964016-47964038 AAATGTTTGTAGCAGCTTGTTGG + Intronic
1108243325 13:48489973-48489995 AACTGTCAGAAGAAGGATGGTGG - Exonic
1108494236 13:51008266-51008288 AAGTGGTTGTAGTAGAATGGTGG - Intergenic
1110403935 13:75127468-75127490 AACAGCTTGTAGAAACATAGTGG + Intergenic
1114003922 14:18290751-18290773 AACAATTTTTAAAAGCATGGTGG - Intergenic
1117520833 14:56549866-56549888 AGCTGTTTTTATAAGCATGTGGG - Intronic
1119827011 14:77665361-77665383 ATATGTTTGTAAATGCATGGGGG - Intergenic
1120095967 14:80387970-80387992 ACCAGTTTGTAGAGGCCTGGGGG - Intergenic
1124566244 15:30816790-30816812 TACTGCTTGAAGAACCATGGGGG + Intergenic
1126040329 15:44584369-44584391 AACTGGATGGAGCAGCATGGAGG - Exonic
1127037687 15:54936803-54936825 AAGTGTTTCTAGTAACATGGAGG + Intergenic
1127661875 15:61107094-61107116 AACTGTTTCCAAAAGCAGGGAGG + Intronic
1128371231 15:67040879-67040901 AATTTTTTGTAGAGACATGGGGG - Intergenic
1129425142 15:75457168-75457190 ACCTGTTTGTTGAGGCATTGAGG + Intergenic
1130438928 15:83931126-83931148 AGCAGCTTGTAGAAGCATGCTGG + Intronic
1132463722 16:68127-68149 ACCTGGATGTAGAGGCATGGCGG - Intronic
1132875974 16:2137548-2137570 AACTATTTGAAAAACCATGGGGG + Intergenic
1133585544 16:7190883-7190905 AACTGTTTAGAGAATCATGAAGG + Intronic
1140439169 16:74973573-74973595 AACTGTTGGGCCAAGCATGGTGG - Intronic
1141260710 16:82451256-82451278 AACTGTATGTATAAACATGGTGG - Intergenic
1141881161 16:86860494-86860516 AACTGTCAGAAGAAGCAGGGAGG + Intergenic
1142609028 17:1097885-1097907 AACTGTTAGTGGAAGAAAGGAGG - Intronic
1146235720 17:31159980-31160002 AAGTGTTGGTGGAAGCATTGGGG + Intronic
1148844835 17:50523518-50523540 AACTGCATGTAGGAGCATGTAGG + Intronic
1148948673 17:51289052-51289074 AACTGTTTGTACAAACAATGTGG - Intronic
1155928555 18:31683902-31683924 AACTGGTTGTAAAAATATGGAGG - Intronic
1156831896 18:41501844-41501866 AAGTATTTCTAGAAGCTTGGGGG + Intergenic
1156849969 18:41714795-41714817 AACTTTTTATAAAAGCATGTTGG + Intergenic
1157378553 18:47189808-47189830 ATCTGTTTGTATAAGCAGAGTGG + Intergenic
1159104966 18:63994939-63994961 AACAGATTGCAGAAGCAGGGAGG + Intronic
1164298838 19:23940515-23940537 AACTGTGTGAAGAATGATGGTGG + Intronic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
1164753462 19:30672602-30672624 ATCTGTTAGTAAGAGCATGGGGG + Intronic
926234723 2:11031248-11031270 AACTCTTTGGAGGAGGATGGGGG - Intergenic
926435778 2:12836101-12836123 AATTGTTAGGGGAAGCATGGGGG - Intergenic
926651038 2:15345846-15345868 AGATGGTTGTAGATGCATGGTGG - Intronic
926708652 2:15857100-15857122 AACTTTCTTTGGAAGCATGGAGG + Intergenic
926786322 2:16521875-16521897 TTCTGTTTGTAAAAGCATTGAGG + Intergenic
929380601 2:41346976-41346998 AACTATTTTTAAAAGCAAGGGGG - Intergenic
930142997 2:47972341-47972363 AACTGTGTGAAGAATAATGGTGG - Intergenic
930359147 2:50357126-50357148 AAAATTTTGTAGAGGCATGGTGG + Intronic
931345325 2:61440484-61440506 AACTTTTTCAAGAAGAATGGAGG - Intronic
931983229 2:67716502-67716524 AACTGTCTGTGGAAGCAAAGTGG - Intergenic
932605360 2:73162071-73162093 ACATGTTTGGACAAGCATGGTGG - Intergenic
933067481 2:77815956-77815978 AAATATTTGGATAAGCATGGTGG + Intergenic
933131205 2:78676136-78676158 AACAGTTGGTGGAAGCATTGTGG - Intergenic
933297072 2:80502992-80503014 AAATTTTTGTAGAAACAAGGAGG - Intronic
933384451 2:81592290-81592312 AACTGTTTGTAAAGGCTTTGGGG + Intergenic
935284870 2:101555728-101555750 AACTGTTTCCAGAAGGCTGGAGG - Intergenic
938927452 2:136057326-136057348 AAGTGTGGGTAGAAGCATTGAGG + Intergenic
939950808 2:148469826-148469848 ACCTGTTGGGAGAAGCATGTTGG - Exonic
942815428 2:180047835-180047857 AACTCTGTGAAGAATCATGGTGG - Intergenic
943686950 2:190828665-190828687 CAGAGTTTGTAGTAGCATGGAGG - Intergenic
945794547 2:214346161-214346183 AACTGTTTTTGAAAGCATGTGGG - Intronic
946765736 2:223038392-223038414 AAAGGTTTGTAGAAACTTGGGGG + Intergenic
948405589 2:237716112-237716134 ATATGTTTTTAGAAGGATGGGGG - Intronic
1169945356 20:10982575-10982597 AAATGTTTGTTGAAGCAATGAGG - Intergenic
1172043757 20:32064437-32064459 AACTGTTGTTAGAAGAAGGGGGG + Intronic
1172075390 20:32292423-32292445 AATTGTTTGTAGAAGTTGGGGGG - Intronic
1173784331 20:45781776-45781798 AACTGTTTGTGTAAACATTGTGG - Intronic
1173931052 20:46819215-46819237 ATTTATTTGTACAAGCATGGAGG - Intergenic
1174962033 20:55168884-55168906 AAATGTTTGAAAAAGCACGGGGG - Intergenic
1175728110 20:61333124-61333146 AACTATTTTTAGAGGCATTGTGG + Intronic
1177450420 21:21258694-21258716 TACTGTTTGTGCACGCATGGTGG + Intronic
1177724349 21:24947876-24947898 AAATGTATGTAGAAGTAAGGAGG - Intergenic
1180428436 22:15221554-15221576 AACAATTTTTAAAAGCATGGTGG - Intergenic
1181360305 22:22329028-22329050 ATCTGTGTGTAGAAACAAGGGGG + Intergenic
1183911851 22:41085764-41085786 AAATGTTTGTAGAGACAGGGTGG + Intergenic
949283527 3:2374337-2374359 AACTGCATGAAGAAGCATGGAGG - Intronic
951011627 3:17688796-17688818 AAGGATTTGTAGAAGCATGAAGG - Intronic
952159398 3:30678586-30678608 AACTGTGTGCAGAAGGATGATGG + Intronic
953578164 3:44129697-44129719 AGATGTTTGTGGAAGCAGGGCGG + Intergenic
954624349 3:52014488-52014510 GGCTGTTGGTAGAAGCCTGGAGG + Intergenic
954720858 3:52561725-52561747 AACTGTCTTTCGAAGCAAGGGGG - Intronic
960148985 3:114232179-114232201 AACTGTTGGTAGCAGTAGGGTGG + Intergenic
963049848 3:141131635-141131657 AATTATATGTAAAAGCATGGAGG - Intronic
963132891 3:141875204-141875226 AAAGATTTGTAGAAGCATGTTGG - Intergenic
970906695 4:21224547-21224569 AATTGTAAGTAGAACCATGGGGG - Intronic
970919715 4:21379703-21379725 AACTGTTTCTTGAAGGATGAAGG - Intronic
971276564 4:25203481-25203503 TACAGTTGGTAGTAGCATGGAGG - Intronic
971327304 4:25655089-25655111 AGCTGTTGGGATAAGCATGGGGG + Intergenic
976160940 4:82198319-82198341 AAATGTCTTTAGAAACATGGGGG - Intergenic
976838707 4:89406426-89406448 AACTTTCTCTAGAAGGATGGTGG - Intergenic
978143003 4:105338818-105338840 AACTGTTTGTATAAGCCTTTTGG - Intergenic
979936753 4:126707891-126707913 TAGTGTTTCAAGAAGCATGGAGG + Intergenic
980390378 4:132137775-132137797 AACTGTTTGTAGCAACAATGTGG + Intergenic
984166880 4:176313288-176313310 AACTGTTTGTAGAAACAGTGTGG - Intergenic
984366677 4:178807582-178807604 AACTTTTTATAAAAGCATTGTGG - Intergenic
984946212 4:184970541-184970563 CAGTTTTTGGAGAAGCATGGAGG - Intergenic
985018115 4:185658831-185658853 AATTTTTTGTACAGGCATGGTGG - Intronic
987075325 5:14376705-14376727 AACTGTTTGTACAAAGATGTTGG - Intronic
987588747 5:19894715-19894737 AGCTGTTTGTACAAGCATTTGGG + Intronic
988270379 5:29006180-29006202 AACTATTTCTGGTAGCATGGTGG + Intergenic
991280133 5:64904089-64904111 AACTGTTTGTAGAAGCATGGTGG - Intronic
991372694 5:65936126-65936148 GACTCTTTGTGGGAGCATGGAGG + Intronic
994213115 5:97108207-97108229 AACTGTTACTAGAAGGAAGGTGG - Intronic
1006282993 6:33070430-33070452 AATTGTTTTTAGAGTCATGGGGG + Intronic
1009677553 6:66845575-66845597 AACTGTTTTTAAATGCATGGAGG - Intergenic
1010016404 6:71109551-71109573 ACCTGGTTCTAGAAGCATGCAGG - Intergenic
1012803490 6:103866233-103866255 AACTGTTTGTACAAACAATGTGG - Intergenic
1013445404 6:110221185-110221207 AACTGACTGTAAAAACATGGCGG - Intronic
1020405488 7:7828759-7828781 CACTGGTTGTACAAGCATTGAGG - Intronic
1020991664 7:15204735-15204757 AACTTTTTGGAAAGGCATGGTGG - Intronic
1023400167 7:39786942-39786964 AGATGTGGGTAGAAGCATGGGGG + Intergenic
1024073095 7:45802693-45802715 AGATGTGGGTAGAAGCATGGGGG + Intergenic
1024926983 7:54627513-54627535 AACTGTGTGTACAAGCAATGTGG + Intergenic
1025054383 7:55753144-55753166 AGATGTGGGTAGAAGCATGGGGG - Intergenic
1025132433 7:56383297-56383319 AGATGTGGGTAGAAGCATGGGGG - Intergenic
1027427362 7:78075052-78075074 AACTGTTTGTACAATCAGTGTGG + Intronic
1030936357 7:115589447-115589469 AACTCTTTGAAGAATGATGGTGG - Intergenic
1031027523 7:116696321-116696343 AAATGTTAGTAGAAGAAAGGGGG + Intronic
1032050482 7:128646387-128646409 AGATGTGGGTAGAAGCATGGGGG + Intergenic
1034089737 7:148352694-148352716 AACTGATGGTAGGAGTATGGGGG + Intronic
1035526809 8:319933-319955 ATCTGTCTGTAAAAGGATGGAGG - Intergenic
1035921848 8:3685634-3685656 GACTGTTTTTAGAGGCCTGGGGG + Intronic
1035973659 8:4283229-4283251 AACTGTTTGCAAAAGGATAGTGG - Intronic
1037439725 8:18903406-18903428 AGCTGTTTTTTGCAGCATGGTGG + Intronic
1037884279 8:22588249-22588271 AACTGCTGGTAGCAGCCTGGTGG + Intronic
1038816119 8:30906222-30906244 AACTATTTGAAGAAGAATGGAGG - Intergenic
1039137438 8:34341468-34341490 AAATATTTTTAGAAGCATGTAGG + Intergenic
1044425914 8:92049782-92049804 AACTTTCTGTAGAAGGATTGTGG - Intronic
1046390114 8:113560138-113560160 AAATGTTTATAGAAGTAAGGTGG - Intergenic
1048527015 8:135212485-135212507 AACTATTTGTGCAAGCATTGTGG - Intergenic
1048944535 8:139432060-139432082 CACCCTTTGAAGAAGCATGGAGG - Intergenic
1051481044 9:17561828-17561850 AATTTTTTGTACAGGCATGGTGG - Intergenic
1051783565 9:20717396-20717418 AACAGTGTGATGAAGCATGGTGG + Intronic
1052350762 9:27456137-27456159 ATCTGTATCTAGAAGGATGGGGG - Intronic
1053001929 9:34581470-34581492 AACTGATTGTATAAGAATTGTGG - Intronic
1062709943 9:137969768-137969790 AACTGTGTGTGGGTGCATGGGGG + Intronic
1186068828 X:5795542-5795564 ATGTGTTTGTGGAAGCAAGGAGG - Intergenic
1186736349 X:12469043-12469065 GATTGTTTTTAAAAGCATGGTGG + Intronic
1188286474 X:28331603-28331625 AAGTGTTTGCAAAAGCATAGGGG - Intergenic
1190293442 X:49008931-49008953 AACTGTTTGTAGAAACTATGTGG + Intergenic
1191732476 X:64352057-64352079 AACTGTTTGTACAAACAATGTGG + Intronic
1191905879 X:66089490-66089512 AATTGTTTGAAGAATGATGGTGG + Intergenic
1193546923 X:82842807-82842829 AAGGGATTGTAGAAACATGGAGG + Intergenic
1194123108 X:89984774-89984796 AACTTTTAGTAGAAGCATAGGGG - Intergenic
1195209214 X:102635909-102635931 CACTGTTTGTGGAACCATTGTGG + Intergenic
1196232157 X:113236673-113236695 ACCTGTTTGTAGAAACAGTGTGG + Intergenic
1196282099 X:113833729-113833751 AACTGTTTGTACAAACAAAGTGG + Intergenic
1197290536 X:124651468-124651490 AACTGGTTCTAGAAGCATTAGGG - Intronic
1199730899 X:150631132-150631154 AACTGTTTGTATAAACAATGTGG - Intronic
1200475966 Y:3642220-3642242 AACTTTTAGTAGAAGCATAGGGG - Intergenic
1200886658 Y:8278584-8278606 TACTGTATGTAGAAGTCTGGGGG - Intergenic