ID: 991281779

View in Genome Browser
Species Human (GRCh38)
Location 5:64922922-64922944
Sequence TAACCCTGGGTGGCTGGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 2, 1: 1, 2: 3, 3: 32, 4: 300}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991281773_991281779 -7 Left 991281773 5:64922906-64922928 CCTGGGCTGCGTGCTCTAACCCT 0: 1
1: 21
2: 52
3: 175
4: 342
Right 991281779 5:64922922-64922944 TAACCCTGGGTGGCTGGGACTGG 0: 2
1: 1
2: 3
3: 32
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991281779 Original CRISPR TAACCCTGGGTGGCTGGGAC TGG Intronic
901171891 1:7265117-7265139 TGACCCTGAGTGGGTGGCACTGG - Intronic
901321053 1:8340014-8340036 CCACCCTGAATGGCTGGGACAGG - Intronic
901464118 1:9409861-9409883 TCCACCTGGGTGGCTGGGTCTGG + Intergenic
901845650 1:11980498-11980520 CAAGCCGGGGTGGCGGGGACTGG + Intronic
901942163 1:12671034-12671056 TAACCCTGGGTGGCAAGGTGAGG - Intergenic
902510051 1:16961516-16961538 CAACCCTGAGAGGCTGAGACAGG - Intronic
902674233 1:17997361-17997383 TAAACCTGGGGTGCTGGGGCTGG + Intergenic
903550205 1:24152813-24152835 TCTCCCTGGCTGGCTGGGCCTGG - Intergenic
904025273 1:27498932-27498954 CAAGCCTGGGAGGCTGGGCCGGG - Intergenic
904378572 1:30096536-30096558 TAACCCGGGGTGCCAGGGGCAGG - Intergenic
904449395 1:30601268-30601290 TTCCCCTGTGTGGCTGGGTCTGG - Intergenic
904658067 1:32064267-32064289 AATCCCTGGTGGGCTGGGACCGG + Intergenic
905056777 1:35101353-35101375 TAATCCTGGGAGGCTGGGGCAGG - Intronic
909049877 1:70754177-70754199 GAACCCTGGGAGGTTGGGATTGG + Intergenic
909715346 1:78701383-78701405 TAACTCTGAGTGGCTGGTACAGG + Intergenic
910012953 1:82487629-82487651 TAAGCCTGGGAGGTTGCGACTGG + Intergenic
913475650 1:119234795-119234817 GAACACTGAGTGGCTGGGCCAGG - Intergenic
913973818 1:143437732-143437754 TAACTCTGGGTCGCTAGCACAGG + Intergenic
914068203 1:144263339-144263361 TAACTCTGGGTCGCTAGCACAGG + Intergenic
914110952 1:144703015-144703037 TAACTCTGGGTCGCTAGCACAGG - Intergenic
915706899 1:157852778-157852800 TAACTCTGGCTGGCTGTGAGTGG + Intronic
916154165 1:161827973-161827995 TAACTCTAGGTAGCAGGGACTGG + Intronic
916433950 1:164759456-164759478 GAATCCTGGGTGGCTGGTTCAGG + Intronic
916540957 1:165753536-165753558 ACACTCTGGGTGGCTGGGGCTGG + Intronic
918962801 1:191302621-191302643 TAATCATGGCTGCCTGGGACTGG + Intergenic
920240364 1:204543257-204543279 TAACACTGGGAGGCCGAGACAGG + Intronic
920340903 1:205274571-205274593 TGACCCTGTGTAGCTGGGGCTGG - Intergenic
920363507 1:205435796-205435818 TAAACCTGGGTGCCTGAGCCAGG + Intronic
920386954 1:205576145-205576167 TGACCCTGGGAGGCTGGCCCAGG - Intronic
920561667 1:206943088-206943110 CAGCCCAGGGTGGCTGGGGCTGG + Intronic
921924077 1:220697441-220697463 GCAGGCTGGGTGGCTGGGACAGG + Exonic
922132964 1:222797125-222797147 TAATCTTGGGAGGCTGAGACAGG - Intergenic
922380397 1:225017757-225017779 TAACCTTGGGTGGCTAGGACTGG - Intronic
922730710 1:227947692-227947714 GCACCCGGGGTGGCTGGGGCCGG - Intronic
924169017 1:241317607-241317629 GAATCCCGGGTGGCTGGGAGTGG - Intronic
924367745 1:243313830-243313852 TTACCCTGGGTGGCTGGAATCGG + Intronic
1062819613 10:524166-524188 TACCCCAGGGAGGCTGGAACTGG + Intronic
1063455963 10:6182872-6182894 AGACCCTGGGGGGCTGGGAAGGG - Intronic
1064777581 10:18795933-18795955 TAATCCGAGGTGGCTGGGACTGG - Intergenic
1064900460 10:20290582-20290604 GTACTCTGGGAGGCTGGGACGGG - Intergenic
1065309452 10:24400412-24400434 GGACCCTGGGTGGCTATGACAGG - Intronic
1066496102 10:35943767-35943789 AAACTCTGGGAGGCTGGGGCAGG - Intergenic
1067024419 10:42831243-42831265 GAAGCCTGGGCTGCTGGGACTGG + Exonic
1067218775 10:44326346-44326368 CCACCTTGGGTGGCTGGGAGGGG + Intergenic
1067802532 10:49368947-49368969 TAGCCCTGGGTAGCTGGCCCTGG + Intronic
1067980058 10:51074406-51074428 AAACTCTGGGTGGCTGGAGCCGG + Exonic
1068661554 10:59628052-59628074 TAACACTGGGAGGCTGAGGCGGG + Intergenic
1071727960 10:88218612-88218634 TAGGCCTGGGAGGCTGGGTCAGG - Intergenic
1073579332 10:104649957-104649979 GAACACTGGGTTGCTGGGGCTGG + Intronic
1073652364 10:105375022-105375044 CAACCTTGTGTGGCTGGGACTGG + Intergenic
1074113576 10:110439342-110439364 GAACTTTGGGAGGCTGGGACGGG + Intergenic
1074270565 10:111949744-111949766 TCACCTTGGGTGGCAGGCACTGG - Intergenic
1074759296 10:116654486-116654508 TAACCCTGGGGAGCTGGGACTGG + Intergenic
1075592656 10:123703735-123703757 TAAGGATGGGTGGCTGGGGCGGG + Intergenic
1076542459 10:131222908-131222930 TTACCCTAGGTGGCTGTGGCCGG + Intronic
1077414847 11:2420193-2420215 CTTCCCTGGGTGGCTGGGGCGGG + Intronic
1077503563 11:2920015-2920037 AGACCCTGGGTGGTGGGGACAGG + Intronic
1077625723 11:3769660-3769682 TCACACTGGGAGGCTGAGACGGG + Intronic
1080121287 11:28680785-28680807 TAAACCTGCATGGCAGGGACTGG + Intergenic
1081808273 11:45901599-45901621 TAACCCTCAGTACCTGGGACTGG + Intronic
1084060237 11:66667951-66667973 TAACACTGGGAGGCTGAGGCGGG - Intronic
1084726163 11:70943557-70943579 TACCCCTGGGCGGCAGGGACAGG + Intronic
1084967004 11:72750217-72750239 TAACCCTTGGGGGCCTGGACCGG - Intronic
1085242455 11:75069950-75069972 TGACCCTGGGCAGCTGGGATTGG - Intergenic
1085350552 11:75795617-75795639 TACCCCAGGCTGGCTGGCACAGG + Intronic
1086523338 11:87697209-87697231 TAGCCCTGGGGTGCTGGGTCTGG + Intergenic
1087701621 11:101441977-101441999 TATCTCTGGCTGGCTGGCACAGG - Intergenic
1088460730 11:110080006-110080028 GCACCCTGGGTGGCTGAGATGGG + Intergenic
1089305638 11:117524672-117524694 TAACCCTGGCTGACTGGGGAAGG - Intronic
1090381151 11:126328547-126328569 GCACCCTGGGTGGCTGGGGCAGG + Intronic
1092123173 12:6058447-6058469 TAACTCTGGGTGGGGGGGTCAGG - Intronic
1092123712 12:6061589-6061611 TAATCCTGGGTGGCAGGGGCAGG - Intronic
1092855483 12:12669535-12669557 TAACACTAGTGGGCTGGGACTGG + Intronic
1096346415 12:50850894-50850916 TAATCCTGGGGGACTGGGACAGG - Intronic
1096625479 12:52892856-52892878 TAATCCTGGGTGGTTGGGTCGGG + Intergenic
1096832100 12:54322754-54322776 AATTCCTGGGTGGCTGGGCCCGG + Intronic
1098362677 12:69670281-69670303 GAGCCCTGGGTGGGTGGGTCTGG + Intronic
1098830884 12:75361122-75361144 TACCTCTTTGTGGCTGGGACTGG + Intronic
1099603936 12:84777833-84777855 TAAAGCTGGGTGACAGGGACAGG + Intergenic
1100243489 12:92733236-92733258 TCACCCTGTGAGGCTGGCACTGG - Intronic
1101844458 12:108351362-108351384 GAACCCTGGGTGTCTTGGAGTGG - Intergenic
1103794825 12:123496122-123496144 TTACTTTGGGGGGCTGGGACAGG - Intronic
1103812992 12:123630760-123630782 TAAAGCTGGGTGGCTGGGCATGG + Intronic
1104439330 12:128782082-128782104 CCACCCTGGGTGCCTGGGGCCGG - Intergenic
1104916254 12:132266391-132266413 TATCAGTGGGTGGCTGGGTCAGG - Intronic
1105320355 13:19314331-19314353 TAACCCTAGGTGGTTGCAACTGG + Intergenic
1105397883 13:20057382-20057404 GAACTCTGGGAGGCCGGGACAGG - Intronic
1105502591 13:20985797-20985819 GCACCCTGGGAGGCTGAGACAGG + Intronic
1107414137 13:40185493-40185515 TAACCATGGGTGGATAGGGCTGG - Intergenic
1107632490 13:42356286-42356308 TGAGCCTGGGTGGCTGTGATAGG + Intergenic
1107845184 13:44505305-44505327 TAACCTTGGGAGGCTGAGGCAGG + Intronic
1107935384 13:45341452-45341474 TAGCCCTGGGTGGGTGGAGCGGG + Intergenic
1112906200 13:104425436-104425458 TAAGGCTGGGTGGCTGTGATAGG - Intergenic
1115711804 14:36059145-36059167 GAACTCTGGGTGGCCGGGTCAGG + Intergenic
1116591492 14:46781366-46781388 TAACTCTGGGGTACTGGGACTGG - Intergenic
1118042768 14:61935450-61935472 TAAGCCTTGGTCGCTGGTACTGG + Intergenic
1118126964 14:62916240-62916262 AAACCCTGGCTGGCTGGGCGTGG - Intronic
1119920546 14:78442153-78442175 CAACTTTGGGAGGCTGGGACAGG + Intronic
1120173903 14:81273685-81273707 GATCTCTTGGTGGCTGGGACTGG + Intronic
1121184374 14:91953757-91953779 TATTCCTGGGGGGCTGAGACAGG - Intergenic
1121288143 14:92752541-92752563 TAGCCCTGGGTGGCAGGAAGGGG + Intergenic
1122318426 14:100839258-100839280 AAGCCCTGGGTCGCTGGGAGTGG + Intergenic
1122713098 14:103675078-103675100 TAACACTGGGAGGCTGAGGCAGG + Intronic
1122817326 14:104320149-104320171 TCACCCTAGGGGGCTGGGCCAGG - Intergenic
1123180879 14:106469060-106469082 CAGCCCTGGGTGCCTGGGTCAGG - Intergenic
1202946017 14_KI270726v1_random:27598-27620 CAGCCCTGGGTGCCTGGGTCAGG + Intergenic
1123433730 15:20239669-20239691 TCACTTTGGGTGGCTGAGACGGG + Intergenic
1125522738 15:40357307-40357329 GAAGCCTGGGGGGCTGGGAGTGG - Intergenic
1125927153 15:43572185-43572207 GCACCTTGGGAGGCTGGGACAGG + Intronic
1125940297 15:43671750-43671772 GCACCTTGGGAGGCTGGGACAGG + Intergenic
1126157894 15:45582475-45582497 TAACACTGGGAGGCTGAGGCAGG + Intergenic
1127880485 15:63153031-63153053 TAATCCTGGGGAGCTGAGACGGG - Exonic
1128066933 15:64770948-64770970 CATCCCAGTGTGGCTGGGACAGG - Intronic
1128850860 15:70954731-70954753 TAACCCTGTGGGACTGGGACTGG + Intronic
1130735490 15:86544178-86544200 TGACCCAGGTTGGCTAGGACTGG + Intronic
1130881231 15:88057735-88057757 CAGCCCTGGGTGGCTGGAAGTGG - Intronic
1131217188 15:90547998-90548020 CTACCCTGGGGGGCTGAGACAGG - Intronic
1131467356 15:92666440-92666462 GAACTCTGGATGGCTGGAACAGG + Intronic
1132677164 16:1125578-1125600 TAACACTGGATGGCTGGGAGAGG - Intergenic
1132979137 16:2726488-2726510 TGACCCTGGGAGGCAGAGACTGG - Intergenic
1133203800 16:4220740-4220762 TAACTCTGGGTGGCTGAGGCAGG + Intronic
1133323605 16:4930236-4930258 GAAGCCTGTGTGGCTGGGTCAGG + Intronic
1133450865 16:5903011-5903033 TAACCATGGGAGGCTGGAAAGGG - Intergenic
1134132393 16:11658582-11658604 TCACTCTGGGAGGCTGAGACAGG + Intergenic
1136850889 16:33611441-33611463 TCACGTTGGGTGGCTGAGACGGG - Intergenic
1137271603 16:46906027-46906049 GAGCCCTGGGTGCCTGGGGCTGG + Intronic
1138218386 16:55226162-55226184 TCAGCTGGGGTGGCTGGGACCGG + Intergenic
1138906421 16:61340669-61340691 TAATCCTAGGTGTCTGGGACTGG + Intergenic
1139159176 16:64482279-64482301 TAACCTTGTGTGACTGGGAGTGG - Intergenic
1139614455 16:68080483-68080505 TAAAGCTTGGTGGCTGAGACTGG - Intergenic
1139731403 16:68948894-68948916 CAATCCTGGGTGGCTGGGTGCGG + Intronic
1139917713 16:70438705-70438727 GAGCCCTGGGAGGCTGGGAGCGG + Intronic
1140220475 16:73040189-73040211 TAGGCCTGGGTGCCTGTGACAGG + Intronic
1141618192 16:85221936-85221958 TGACCCTGTGGGGCGGGGACCGG - Intergenic
1142190409 16:88714745-88714767 TGGCCATGGGTGGCAGGGACAGG - Intronic
1142514092 17:415749-415771 CAACACTGGGAGGCTGGGGCAGG + Intronic
1143216012 17:5225512-5225534 TAACTTTGGGTGGCTGAGGCAGG + Intronic
1143428659 17:6862571-6862593 TAACCCTGGGGGGCTAGTATTGG + Intergenic
1143483892 17:7242368-7242390 GAACCCAGGGGGGCCGGGACGGG + Exonic
1143511657 17:7399249-7399271 TAATCCTGGGAGGCTGAGGCAGG - Intronic
1146002483 17:29139604-29139626 TTACCCTTGGTGGCTGGGAGGGG + Intronic
1146401656 17:32504495-32504517 TGACCCTGGGTGGCTGGGGTGGG + Intronic
1146942300 17:36851772-36851794 ACACCCTGGGTGGCTGAGCCAGG + Intergenic
1147375949 17:40022599-40022621 TGACCCTGGGTGGCCGGAGCAGG + Intronic
1148459770 17:47832567-47832589 TAGTCCTAGGTGGCTGAGACAGG + Intronic
1148773738 17:50081574-50081596 TAACCCCGGGTCCCTGGGAGTGG + Intronic
1149127723 17:53255269-53255291 TAATTCTGGGGGGCTGGTACTGG - Intergenic
1149134597 17:53349315-53349337 AAATTCTGGGAGGCTGGGACAGG + Intergenic
1151960834 17:77404853-77404875 TGAGTCTGGGTGGCTGGGGCAGG - Intronic
1153839013 18:8989767-8989789 TAATCCTGGGAGGCTGAGGCAGG - Intergenic
1155176125 18:23302758-23302780 CCACCCTGGCTGGCTGAGACTGG - Intronic
1156288320 18:35721721-35721743 TAACCCTGGGAGGTTAGGACTGG - Intergenic
1156492206 18:37502880-37502902 CAGCACTGGGTGCCTGGGACAGG - Intronic
1157767611 18:50312404-50312426 TAACCTTGGGAGGCTGAGGCAGG - Intergenic
1158755558 18:60320506-60320528 TAATTCTGGCTGGCTGGAACTGG + Intergenic
1158768424 18:60484723-60484745 TAACCCTAGGGGACTGGGAATGG - Intergenic
1158938400 18:62385104-62385126 GATCCCTGGGTGGCCGGGGCTGG - Exonic
1160804937 19:988489-988511 AAACCCAGGGTGGCTGGGGAGGG - Intronic
1161128510 19:2574054-2574076 TCACCTTGGGTGCCTGGGTCTGG + Intronic
1161176834 19:2848440-2848462 AAATCCTGGGTGGCTGGGTGCGG - Intronic
1161819445 19:6520625-6520647 GCACCCTGGGAGGCTGAGACGGG + Intergenic
1162815401 19:13191200-13191222 TCTCCCTGGCTGGCTGGGGCGGG + Intergenic
1163263642 19:16205710-16205732 TGACCCTGGGAGGCAGGGGCTGG + Intronic
1163735723 19:18979238-18979260 TGAGCCTGGGTGGCTGGGAGTGG + Intergenic
1163904871 19:20143611-20143633 AAACTCTGGGTGTCTGGGAATGG - Intergenic
1163984051 19:20928363-20928385 GAACTCTGGGTGTCTGGGAAGGG + Intronic
1164095405 19:22005410-22005432 AAACTCTGGGTGTCTGGGAATGG - Intronic
1164136128 19:22417980-22418002 AAACTCTGGGTGTCTGGGAATGG - Intronic
1164275089 19:23710114-23710136 TAAACATGGGTGGCTGGGCGTGG - Intergenic
1165029941 19:32990781-32990803 TCACTTTGGGTGGCTGAGACGGG + Intronic
1165242337 19:34478901-34478923 GAACACTGGGAGGCTGAGACGGG - Intergenic
1166217372 19:41344417-41344439 TGACCCAGAGTGGGTGGGACTGG - Intronic
1166424440 19:42663162-42663184 TAACCCTTGGGGGCAGGGAAGGG + Intronic
1166882311 19:45937128-45937150 TCACCCTGGCTGGCTGGGTAGGG + Exonic
1167615794 19:50532373-50532395 TAGCCATGGGAGGCTGGGAGTGG - Intronic
1167982983 19:53291279-53291301 TCAGCCTGGGTGGCTGGGCCCGG - Exonic
1168599549 19:57706863-57706885 GAACTCTGGGTGGCTGAGGCGGG + Intronic
925300146 2:2805882-2805904 TACCCCTGGGGTCCTGGGACTGG - Intergenic
925469041 2:4139109-4139131 GAACTCTGGGAGGCTGAGACAGG + Intergenic
926929383 2:18022393-18022415 TAACCCTGGGTGGCTGGGACTGG + Intronic
928238511 2:29566115-29566137 TGACCCTGGGTGGGTGGCCCTGG - Intronic
928555727 2:32423047-32423069 TAACCTTGGGAGGCTGAGGCAGG - Intronic
929375707 2:41284347-41284369 TACCTCTGGGTGGCAGGGAGGGG - Intergenic
929930982 2:46255255-46255277 TAACCATTGGTGGCTCTGACGGG - Intergenic
930146112 2:48006263-48006285 GAACCCTGGTTGGCTGAGGCAGG + Intergenic
931219462 2:60276283-60276305 GAGCCCTGGGTGGCTGGAATTGG - Intergenic
931549283 2:63424603-63424625 TAACCCTGGGGGATTGGGACTGG - Intronic
931682573 2:64763949-64763971 TAACCATGTGTGGCCAGGACTGG + Intergenic
932137367 2:69243004-69243026 TAAGCCGGGGAGGCTGTGACTGG - Intronic
932711482 2:74067823-74067845 GAGCCCTTAGTGGCTGGGACAGG + Intronic
934288806 2:91672982-91673004 TAACTCTGGGTCGCTAGCACAGG + Intergenic
937613364 2:123890721-123890743 TAAATCTGGGTGTCTGGGGCAGG - Intergenic
945611621 2:212011502-212011524 GCACCCTGGGAGGCTGAGACGGG + Intronic
945658796 2:212659200-212659222 TAACCCTAGGGGTCTGGGACTGG + Intergenic
946458835 2:219851567-219851589 TAACCCTGGCTGCCTGCGTCTGG + Intergenic
947808046 2:232982055-232982077 CAGCCCTGGGTGACTGGGACTGG + Intronic
948055566 2:235007385-235007407 TGTCCCTGGGGGGCTGGGAGAGG - Intronic
948626415 2:239271649-239271671 AAAGCCTGGGTGGCTGAGGCCGG + Intronic
948772226 2:240257483-240257505 TTGCCCTGGGTGGCTGTGGCTGG - Intergenic
948869210 2:240789877-240789899 CAGCCCAGGGTGCCTGGGACTGG - Intronic
1169407223 20:5331931-5331953 GTACCCTGGGAGGCTGAGACAGG - Intergenic
1169500686 20:6157887-6157909 CAACCCTGGGGTGCTGGGACTGG + Intergenic
1171439409 20:25148436-25148458 TGGCCCTGGGTGTCTGGGCCGGG + Intergenic
1171472273 20:25381748-25381770 TAATCCTGGGAGGCTGAGGCAGG - Intronic
1172979746 20:38931972-38931994 TGTCCCTGGGTGGCTGTGCCTGG + Intronic
1173332402 20:42086183-42086205 GCACTCTGGGAGGCTGGGACAGG - Intronic
1174400804 20:50274913-50274935 GAACCCTGGGTGCCTGAGTCAGG + Intergenic
1175202151 20:57285453-57285475 GAACCCTGGGAGGCTGGGTGCGG - Intergenic
1177760357 21:25396032-25396054 TAACCTTGGGTAGCTGACACAGG + Intergenic
1178060534 21:28849190-28849212 TAACTCTGGGGGGCTGGTACTGG - Intergenic
1178534195 21:33399052-33399074 TACCCTTGGGAGGCTGGGGCAGG - Intergenic
1180786187 22:18549156-18549178 TAACCCTCTGTGGCTGTGAGCGG + Intergenic
1180854149 22:19035845-19035867 TAACATTAGGTGGCTTGGACTGG + Intergenic
1181131472 22:20734882-20734904 TAACCCTCTGTGGCTGTGAGCGG + Intronic
1181243109 22:21488710-21488732 TAACCCTCTGTGGCTGTGAGCGG + Intergenic
1182898761 22:33880564-33880586 TAAGCCTGGGAGGATGGGTCAGG - Intronic
1183258605 22:36779437-36779459 TAACCCTGGGTGGATGGAGAGGG + Intergenic
949231557 3:1756659-1756681 TAGCCCTGGGTTGCTTGGATGGG - Intergenic
949763462 3:7499066-7499088 AATCACTTGGTGGCTGGGACTGG + Intronic
949866663 3:8552967-8552989 TAACCTTGGGAGGCTGAGGCGGG - Intronic
950037420 3:9896917-9896939 TAAACTTGGGAGGCTGGGGCAGG + Intergenic
953928893 3:46996343-46996365 TAGGCCAGGGTGGCGGGGACTGG - Exonic
955534098 3:59904808-59904830 TTCCCCTGTGTGGCTGGGCCTGG + Intronic
956565998 3:70639406-70639428 GAATCCTGAGTAGCTGGGACTGG + Intergenic
956831090 3:73048972-73048994 TACCCCTGGGGGCCTGGGATGGG + Intronic
958462737 3:94419135-94419157 TAGCCCTGAGGGGCTGGTACTGG - Intergenic
962768846 3:138593992-138594014 AAAGCCTGGGGAGCTGGGACTGG + Intronic
964079402 3:152734209-152734231 TAACTCTGGGAGGCTGAGGCAGG - Intergenic
966162807 3:176985648-176985670 TAAACATCGGTGGATGGGACTGG + Intergenic
966289083 3:178334108-178334130 TAACTCTGGGAGGCTGGTACTGG + Intergenic
968209116 3:196833182-196833204 TAGCACTGGGAGGCTGAGACTGG + Intergenic
968602490 4:1516949-1516971 TAAGCCAGGCTGGCTGGGCCAGG + Intergenic
969373530 4:6748672-6748694 TCAGCCTGGGAGGGTGGGACCGG - Intergenic
972097960 4:35372214-35372236 CTACCTTGGGAGGCTGGGACAGG + Intergenic
972318217 4:37947570-37947592 TAACCTGGGGAGGTTGGGACAGG - Intronic
974914331 4:68161269-68161291 TAATCCCGGGGGACTGGGACTGG + Intergenic
977584126 4:98756923-98756945 TAACCATGGATGGCTGGGTGTGG - Intergenic
978336908 4:107679047-107679069 TCACCCTGGGAGGCTTGGAGGGG - Intronic
978379547 4:108112428-108112450 TGCCCATGGGTGGGTGGGACTGG - Intronic
979610469 4:122683850-122683872 TCAGCCTGTGTAGCTGGGACTGG - Intergenic
980467160 4:133201515-133201537 TAAATCTGTGGGGCTGGGACTGG + Intronic
980704499 4:136475187-136475209 TAACCCTGGGGGGCTGCCTCTGG - Intergenic
980768316 4:137337273-137337295 TAATCCTAGGTGGCTGGAAATGG - Intergenic
980792066 4:137632636-137632658 TAACTCTGGGGGGCTGGTATGGG - Intergenic
982072226 4:151705602-151705624 TTACCCTGGGAGTCTGGGATGGG + Intronic
985395548 4:189539342-189539364 TAAACCTGGGAAGCTGGTACTGG - Intergenic
985731550 5:1552198-1552220 AAACCCTGTGTGGCTGAGCCTGG + Intergenic
986817652 5:11430136-11430158 GACACCTGGGAGGCTGGGACAGG + Intronic
987159903 5:15131856-15131878 TTACTCTGGGAGGCTGGTACTGG + Intergenic
987995778 5:25276521-25276543 TTCCCCTGGGTTGATGGGACAGG - Intergenic
988088826 5:26508368-26508390 TATCCCAGTGTGGCTGGGTCTGG - Intergenic
991281779 5:64922922-64922944 TAACCCTGGGTGGCTGGGACTGG + Intronic
992117255 5:73551507-73551529 TAACACTGGGAGGCTGAGGCAGG - Intergenic
992236895 5:74719410-74719432 GAATCCTTGGTGGATGGGACAGG + Intronic
994030286 5:95133764-95133786 TAACCATGGGTGACTGAAACTGG + Intronic
995516753 5:112962021-112962043 TTCCCCTGAGTAGCTGGGACAGG + Intergenic
998463369 5:142325182-142325204 TAACCCGTGATTGCTGGGACTGG + Intronic
999183315 5:149686169-149686191 TTTCCCTGGGAGGCTGGCACCGG + Intergenic
1001671438 5:173477479-173477501 TAAGCTTGGGTGGCTGGCCCTGG + Intergenic
1002094840 5:176824655-176824677 TTTTCCTGGGTGGCTGGGGCTGG + Intronic
1002106309 5:176880978-176881000 GAGTCCTGGGTGGCTGGGCCTGG + Exonic
1002337168 5:178487814-178487836 AAACCCTGGGTCACTGGAACAGG + Intronic
1002374094 5:178775799-178775821 CAAGCCTGCATGGCTGGGACTGG - Intergenic
1003004767 6:2370348-2370370 CACCCCTGGGTTGCTGGGATTGG + Intergenic
1004235685 6:13872936-13872958 TAAACCTGGGTGGGTGGTAAGGG - Intergenic
1004720091 6:18261324-18261346 AAACTCTGGGAGGCTGAGACGGG + Intronic
1006599656 6:35217057-35217079 TAAGCCTGTGTGACTGGGAAGGG + Intronic
1007268629 6:40618381-40618403 TTACCCTGGTTGGCTGGTCCTGG + Intergenic
1007797307 6:44360212-44360234 AAACCTTGGGAGGCTGAGACAGG - Intronic
1009621533 6:66084465-66084487 TAACTCTGGGGGGCTGGTATTGG + Intergenic
1009844877 6:69122200-69122222 GCACCCTGGGAGGCTGAGACGGG + Intronic
1012253593 6:97007786-97007808 TAACTCTGGGGGGCTGGCAGTGG + Intronic
1012889061 6:104878611-104878633 TAACACTGGGAGGCTGAGGCAGG + Intergenic
1013370902 6:109470313-109470335 TCACCCTGGGTGGGTGGGATTGG - Intronic
1013482344 6:110563421-110563443 TAACCCAGGGAGGCTGAGGCTGG - Intergenic
1015493521 6:133855146-133855168 GCACCCTGGCTGGCTGGGGCCGG - Intergenic
1016107841 6:140184933-140184955 TAACCCTGGGTGCCTGGAACTGG - Intergenic
1016935153 6:149444185-149444207 TGACACTGGGTGGCTGACACTGG - Intergenic
1016935205 6:149444707-149444729 AAACACTGGGTGGCTGACACTGG - Intergenic
1017791113 6:157800389-157800411 CAACCCTGGGAGGCTGCGGCAGG + Intronic
1018890565 6:167978482-167978504 ACACCCGGGGTGGCAGGGACCGG + Intergenic
1018948405 6:168363022-168363044 TAACTGTGGGTGACTGGCACTGG + Intergenic
1021894670 7:25222647-25222669 TAAACATGGGTGGCGGGGAATGG + Intergenic
1022549999 7:31229185-31229207 CAGCCTTGGGTGGCAGGGACAGG + Intergenic
1022822713 7:33976758-33976780 TAACTCTGGCTGGCTGTCACTGG - Intronic
1025049419 7:55721936-55721958 TAGCCCTGGGGGGCTGGGCGAGG - Intergenic
1025815546 7:64907749-64907771 GAACTCTGGGTGTCTGGGAATGG + Intronic
1025865783 7:65379370-65379392 GAACTCTGGGTGTCTGGGAATGG + Intronic
1026768021 7:73172658-73172680 AAGCCCTCGGTGGCTGGGGCAGG - Intergenic
1026930573 7:74220940-74220962 TAACCCTGGGTTTGGGGGACTGG + Intronic
1027044487 7:74982368-74982390 AAGCCCTGGGTGGCTGGGGCAGG - Intronic
1027079152 7:75219992-75220014 AAGCCCTCGGTGGCTGGGGCAGG + Intergenic
1028185966 7:87785443-87785465 CAACCCTGGGAGGTTGGGACTGG + Intronic
1028369864 7:90078991-90079013 AAACCCTGGGAGGCAGGGAAGGG + Intergenic
1029388383 7:100258571-100258593 AAGCCCTGGGTGGCTGGGGCAGG + Intronic
1032505885 7:132434364-132434386 CCACCCTGGGCAGCTGGGACAGG - Intronic
1033353701 7:140582733-140582755 TGACCCTGTGGGGCTGGGACAGG + Intronic
1034646462 7:152652054-152652076 TCACCCTGAGTAGCTGAGACTGG - Intronic
1035771503 8:2150804-2150826 TAAAACTGGGAGGCTGAGACAGG - Intronic
1035894579 8:3384034-3384056 CAACCCTGGGAGGCAGTGACTGG + Intronic
1039667232 8:39547323-39547345 TAACTCTGGGTGGCTGGGACTGG + Intergenic
1039957432 8:42218118-42218140 CCACCCTGTGGGGCTGGGACAGG + Intergenic
1040106572 8:43545407-43545429 TCCCCCTGGGTGACAGGGACAGG - Intergenic
1040107044 8:43547150-43547172 TCCCCCTGGGTGACGGGGACAGG - Intergenic
1043118908 8:76296949-76296971 TCACTCTGGGTGGCTGAGGCCGG + Intergenic
1044682698 8:94798475-94798497 TAACCATGAGAGGCTGGGAGAGG - Intergenic
1046216284 8:111152136-111152158 TAACTCTGAGTGGCAGGGACTGG + Intergenic
1046560219 8:115827090-115827112 GCACCCTGGGTGGCTGAGGCTGG - Intergenic
1047519130 8:125580899-125580921 TAGCCCTGGTTGGCTGTGAGAGG + Intergenic
1047593447 8:126351684-126351706 TAACACTGGGTGGGTGGGTGGGG + Intergenic
1048637907 8:136318861-136318883 AAACCCTGCTTGGCTGGGAGTGG - Intergenic
1048784938 8:138040382-138040404 TCATCCTGAGTTGCTGGGACAGG + Intergenic
1048866927 8:138768187-138768209 GAACCATGGGGGGCTGGGAAAGG - Intronic
1049825321 8:144663918-144663940 GCACGCTGGGTGGCTGAGACAGG + Intergenic
1050312862 9:4371243-4371265 AAATCCTGGCTGACTGGGACAGG + Intergenic
1050544895 9:6701422-6701444 TGACACTGGGAGGCTGGGGCAGG + Intergenic
1052908486 9:33858650-33858672 GAACCCTGGGAGGCTGGGGTGGG - Intronic
1057632394 9:96730809-96730831 CAACACTGGGAGGCTGAGACAGG - Intergenic
1060513210 9:124249122-124249144 TGGCCCTGGTTGGCTGGGAATGG - Intergenic
1061404731 9:130387115-130387137 CATCCTTGGGTGGATGGGACAGG - Intronic
1061652320 9:132060700-132060722 GCACACTGGGAGGCTGGGACGGG + Intronic
1061844589 9:133379907-133379929 TCACCCTGTATGGCTGGGCCTGG + Intronic
1062364003 9:136200374-136200396 GCTCCCTGGGTGGCTGGGCCTGG - Intronic
1062399410 9:136365868-136365890 TCCCCCTGGGTGGCTGTGGCAGG - Intronic
1062506371 9:136879408-136879430 TAATCCTGGGAGGCTGAGGCAGG + Intronic
1062585115 9:137245681-137245703 GAACCCTCGGGGGCTTGGACTGG + Exonic
1185464870 X:348283-348305 TAACCCTGGCTGGCTGGGCGTGG + Intronic
1189424146 X:40882850-40882872 TGACCCTGGGGGGCAGGGAAAGG - Intergenic
1189853622 X:45200938-45200960 GAAACCTGGGAGGCTGGGATGGG - Intergenic
1191955368 X:66638287-66638309 TCATGCTGGGTGGCTGGGGCAGG - Intronic
1192472154 X:71408559-71408581 TAATCCTGGGAGGCTGAGGCGGG - Intronic
1192887680 X:75353287-75353309 TAACACTGGGAGGCTGAGGCAGG - Intergenic
1193635288 X:83943241-83943263 TAACTCTGGGGGACTGGTACTGG + Intergenic
1195144622 X:102000579-102000601 TAACTCTAGGGGGCTGGTACAGG - Intergenic
1195380980 X:104270521-104270543 TAAAACAGGGTGGCCGGGACTGG - Intergenic
1196813057 X:119643814-119643836 CCACCCTAGGTGGCTGGGAGAGG - Intronic
1199640863 X:149859382-149859404 TAACTGTGGGGGGCTGAGACTGG - Intergenic
1199786527 X:151111589-151111611 TAACTCTGGAGGGCTGGTACTGG + Intergenic