ID: 991284658

View in Genome Browser
Species Human (GRCh38)
Location 5:64958971-64958993
Sequence GAGGCTTATTGACCACCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991284654_991284658 8 Left 991284654 5:64958940-64958962 CCACTTTTAACTAATTTTCATGA 0: 1
1: 0
2: 6
3: 31
4: 456
Right 991284658 5:64958971-64958993 GAGGCTTATTGACCACCAGATGG No data
991284652_991284658 23 Left 991284652 5:64958925-64958947 CCCTAAATTATTTAACCACTTTT 0: 1
1: 2
2: 7
3: 109
4: 832
Right 991284658 5:64958971-64958993 GAGGCTTATTGACCACCAGATGG No data
991284653_991284658 22 Left 991284653 5:64958926-64958948 CCTAAATTATTTAACCACTTTTA 0: 1
1: 0
2: 9
3: 69
4: 553
Right 991284658 5:64958971-64958993 GAGGCTTATTGACCACCAGATGG No data
991284651_991284658 24 Left 991284651 5:64958924-64958946 CCCCTAAATTATTTAACCACTTT 0: 1
1: 0
2: 4
3: 49
4: 391
Right 991284658 5:64958971-64958993 GAGGCTTATTGACCACCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991284658 Original CRISPR GAGGCTTATTGACCACCAGA TGG Intronic
No off target data available for this crispr