ID: 991285438

View in Genome Browser
Species Human (GRCh38)
Location 5:64970150-64970172
Sequence CTGTAGGATAAGAAGAAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991285436_991285438 0 Left 991285436 5:64970127-64970149 CCAGGACAATGCAAATCTAACTA 0: 1
1: 0
2: 0
3: 9
4: 127
Right 991285438 5:64970150-64970172 CTGTAGGATAAGAAGAAGAGAGG No data
991285435_991285438 1 Left 991285435 5:64970126-64970148 CCCAGGACAATGCAAATCTAACT 0: 1
1: 0
2: 0
3: 15
4: 182
Right 991285438 5:64970150-64970172 CTGTAGGATAAGAAGAAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991285438 Original CRISPR CTGTAGGATAAGAAGAAGAG AGG Intronic
No off target data available for this crispr