ID: 991286138

View in Genome Browser
Species Human (GRCh38)
Location 5:64978307-64978329
Sequence ACAAGTGCTTTCAGGGTCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 4, 3: 17, 4: 157}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991286138_991286142 16 Left 991286138 5:64978307-64978329 CCTAGGACCCTGAAAGCACTTGT 0: 1
1: 0
2: 4
3: 17
4: 157
Right 991286142 5:64978346-64978368 TTATAGTTTTCATATGATGTGGG 0: 1
1: 0
2: 5
3: 90
4: 1200
991286138_991286141 15 Left 991286138 5:64978307-64978329 CCTAGGACCCTGAAAGCACTTGT 0: 1
1: 0
2: 4
3: 17
4: 157
Right 991286141 5:64978345-64978367 TTTATAGTTTTCATATGATGTGG 0: 1
1: 0
2: 0
3: 38
4: 471

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991286138 Original CRISPR ACAAGTGCTTTCAGGGTCCT AGG (reversed) Intronic
903450329 1:23449478-23449500 ACAGATGCTATCAGGGCCCTGGG + Intronic
904233464 1:29097067-29097089 ACAAGAGCATTCAGGATCATAGG + Intronic
905920050 1:41713241-41713263 ACAAGTGCTTTCAGGGCAGTGGG - Intronic
909968055 1:81942980-81943002 ACAATTGCTTTCAAGGTCCCAGG - Exonic
912513394 1:110203097-110203119 GCAGGTTCCTTCAGGGTCCTTGG - Intergenic
913684002 1:121214568-121214590 AAAAGTCCCTTCACGGTCCTTGG + Intronic
914035841 1:144002183-144002205 AAAAGTCCCTTCACGGTCCTTGG + Intergenic
914153615 1:145065762-145065784 AAAAGTCCCTTCACGGTCCTTGG - Intronic
920471307 1:206233060-206233082 AAAAGTCCCTTCACGGTCCTTGG + Intronic
921366022 1:214374667-214374689 ACAAGTTCTTGCAAGGTCCACGG + Intronic
921816896 1:219574495-219574517 AAAAGTGTTTTCATGATCCTTGG - Intergenic
922218571 1:223540424-223540446 TCCTTTGCTTTCAGGGTCCTGGG - Intronic
922749710 1:228064726-228064748 ACACCTACTTTCAGGATCCTGGG + Intergenic
923455949 1:234165738-234165760 ACAAGTGCTTTTAGGTTACATGG + Intronic
923858852 1:237872648-237872670 ACTAGTGCCCTCAGGTTCCTGGG + Intergenic
1063457523 10:6194720-6194742 CCAAGAGCTTTCAAGGGCCTTGG + Intronic
1065047452 10:21757199-21757221 ACAAGTTCTGCCAGTGTCCTGGG - Intronic
1065921879 10:30399955-30399977 ACAAGTGATTTAAGAGCCCTTGG + Intergenic
1067196716 10:44126166-44126188 ACATGTGTTTTCAGGTTCCAGGG - Intergenic
1067718265 10:48706051-48706073 ACAGTGGCTTTCAGAGTCCTGGG + Intronic
1068419242 10:56768114-56768136 AGAAGAGCTTTAAGGTTCCTGGG - Intergenic
1071593416 10:86898396-86898418 ACAAGGGCTTTCATCTTCCTGGG + Intronic
1074065799 10:110012465-110012487 ACAATTCCTTTCAGGCTTCTAGG + Intronic
1074528778 10:114282594-114282616 ACAGGTTCTTTCAGGGCCCTGGG + Intronic
1078867197 11:15308825-15308847 ACAAGTGCTTTCTGGTTCCTAGG - Intergenic
1078975903 11:16476338-16476360 ACCAGTGATTTCTGGGTGCTGGG - Exonic
1083417384 11:62534475-62534497 ACGAGTGCTTTCAGGGTCCAAGG - Intronic
1083473789 11:62902372-62902394 ACAGGTGCTTGAAGGCTCCTGGG + Intergenic
1087424879 11:97973005-97973027 CCCAGTGCCTTCAGGGTGCTGGG - Intergenic
1089231023 11:116976700-116976722 ACAACTGCGTTCTGGGTCCTAGG - Intronic
1089484022 11:118830909-118830931 ACAAGTTCTTTCAGTGCCCTAGG - Intergenic
1090225939 11:125072411-125072433 ACAAGGTCTTTGAGGGTCATGGG + Intronic
1090640246 11:128723807-128723829 ACAAGTGCTTTCATGGTGCTAGG + Intronic
1090869008 11:130726403-130726425 CCAAGTTGTTTCAGGGTCCAGGG + Intergenic
1092284424 12:7120634-7120656 ACCCATGCTTTCAGGGTCCCTGG - Intergenic
1092969824 12:13682818-13682840 AAAAGTGCTTTCAGCCCCCTTGG + Intronic
1093210302 12:16300266-16300288 ACAAATGATTTCAGGGGCCCAGG + Intergenic
1093615471 12:21217584-21217606 ACAAGTTCTTTTAGGATCCTAGG - Intronic
1094727569 12:33136634-33136656 ACAAGTAGTTTCAGGTTACTTGG - Intergenic
1098281395 12:68866168-68866190 TCCAGTGTTCTCAGGGTCCTTGG + Intronic
1098285613 12:68904128-68904150 CCCAGTGCTTTCAGGGGCCAAGG - Intronic
1101713263 12:107288345-107288367 CTAAGTGCTTGCAGGGTCCCAGG - Intergenic
1101988129 12:109463214-109463236 ATAATTGATTTCAGGGCCCTGGG - Intronic
1102148687 12:110673605-110673627 AAAAGTGGTTTCATGGGCCTAGG + Intronic
1102188907 12:110971036-110971058 ACAAAAACTTTCAGGCTCCTGGG - Intergenic
1104139781 12:125976323-125976345 ATTAGTGCTTGCAGGGTCTTGGG + Intergenic
1105487136 13:20845870-20845892 AAAATTGTTTTCAGGATCCTAGG - Intronic
1107988656 13:45797888-45797910 ACAAGTCCCTGCAGGGTCCATGG + Intronic
1108598501 13:51970808-51970830 ACAAGAGGTTTCAGGGCTCTTGG + Intronic
1110289361 13:73786295-73786317 AGAAGTGTTTTTAGGGTTCTTGG - Intronic
1111795588 13:92915221-92915243 ATAATTGCTTTCAAGGTGCTTGG - Intergenic
1116969687 14:51051385-51051407 ACAGGTCCTCTGAGGGTCCTTGG - Intronic
1117519101 14:56532273-56532295 ACAACAGCCTTCAGGGTGCTTGG - Intronic
1118019531 14:61696056-61696078 GAAAGTGCTTTCAGGGGCCGGGG + Intronic
1119462917 14:74825503-74825525 ATAAGTGCTTTAAGGGTCTCTGG - Intronic
1121428171 14:93868139-93868161 ACAGGTGCTTTCAGAGTCTGAGG + Intergenic
1125272355 15:37953090-37953112 AGAGGTGCTTTCAGGGGCCAGGG - Intronic
1125766818 15:42141830-42141852 GCAAGAGCTTTCCGGGGCCTGGG + Exonic
1126308262 15:47286140-47286162 ACAAGTGGTTTCAGAGACCAAGG - Intronic
1126651851 15:50931119-50931141 ATAAATGCTTTCAGGTTGCTGGG + Intronic
1126999179 15:54481941-54481963 GCAAGTGCCTTCAAGGGCCTTGG - Intronic
1129477424 15:75795554-75795576 ACAAGTGCCTTCAGAGCCCTTGG - Intergenic
1129737201 15:77973051-77973073 ACAGGTGCTTTAAGGGACCCTGG + Intergenic
1129848877 15:78780584-78780606 ACAGGTGCTTTAAGGGACCCTGG - Intronic
1130253075 15:82313496-82313518 ACAGGTGCTTTATGGGACCTTGG + Intergenic
1133039391 16:3052375-3052397 CCACATGCTTTCAAGGTCCTTGG - Intronic
1133972282 16:10577023-10577045 ACACGTGCTATAAGGGTCCCAGG + Intronic
1137314081 16:47298861-47298883 AGAAGCGCTTTCAGTGTCCCAGG + Intronic
1138418401 16:56884421-56884443 ACAGGGGATTCCAGGGTCCTGGG - Intronic
1141486043 16:84340938-84340960 AAAGCTGCTTTCAGGGTCCTTGG - Intergenic
1141783076 16:86177466-86177488 CCAAGTGATGTCAGGATCCTGGG + Intergenic
1141933408 16:87219778-87219800 AGAGGTGCGTTCAGCGTCCTCGG - Intronic
1144626841 17:16848190-16848212 AGCAGTGCTTACAGGGGCCTGGG - Intergenic
1144879597 17:18424522-18424544 AGCAGTGCTTGCAGGGGCCTGGG + Intergenic
1145152643 17:20519865-20519887 AGCAGTGCTTGCAGGGGCCTGGG - Intergenic
1147747151 17:42701762-42701784 AGAAGTGTTTTCAGATTCCTGGG - Exonic
1151649495 17:75457292-75457314 AGAAGCGTTTTCAGGCTCCTCGG + Intronic
1153208042 18:2724964-2724986 ACAAGAGTTTACAGGGCCCTTGG - Exonic
1154148801 18:11889346-11889368 ACAAGAGCTCTCAGGGTGCAGGG + Intronic
1154210133 18:12372545-12372567 ACATGTGTTTTCAGCTTCCTTGG - Intronic
1156006971 18:32453457-32453479 ACACTTCCTTTGAGGGTCCTAGG + Intronic
1160426943 18:78784171-78784193 ACATGTGCCTCCAGGGTCTTAGG - Intergenic
1164467927 19:28503781-28503803 AAAAGGGCTTTCAAGGTCCGAGG + Intergenic
1165383608 19:35497496-35497518 ACCAGTGCTTTTCGGGGCCTCGG + Exonic
1166668229 19:44694337-44694359 ACAAGTGAATTCAAGGCCCTGGG - Intergenic
925916674 2:8611921-8611943 ACAAGGGCTTTCAGCGTTCAAGG - Intergenic
926234914 2:11033433-11033455 ACAAGGCCTTCCAGGTTCCTAGG - Intergenic
931800758 2:65755870-65755892 ACAAGAGATTTCAGGGGCCAGGG - Intergenic
931862094 2:66366062-66366084 ACATGGGTTTTCAGGGTCATAGG - Intergenic
932449765 2:71802062-71802084 ACATCTGCCTTCTGGGTCCTGGG - Intergenic
935951086 2:108329448-108329470 AGATGAGTTTTCAGGGTCCTTGG - Intergenic
936918463 2:117663723-117663745 ACAAGTGCATTCAGTACCCTGGG - Intergenic
945019428 2:205556405-205556427 TCAAGTGCTTTCATGGAACTCGG + Intronic
945276514 2:207992875-207992897 CCATGTGCTTTCAAGCTCCTGGG - Intronic
948171414 2:235906431-235906453 ACAAGATGTTTCAGGGTCCCTGG - Intronic
949065394 2:241987255-241987277 TCAAGTCCTTTCAGAGTACTCGG + Intergenic
1173710388 20:45150610-45150632 ACACCTGATTTCAGGGTCATGGG + Intergenic
1176670295 21:9727804-9727826 ACATGTGCTCTCAGTCTCCTAGG - Intergenic
1178100365 21:29261620-29261642 AAAAGTGCTTGCAGGGTCTTTGG + Intronic
1178959696 21:37053576-37053598 ATAAGTGATTTCAGCCTCCTAGG + Intergenic
1179904661 21:44416197-44416219 ACAAGGATTTTCAGAGTCCTGGG - Intronic
1181267905 22:21641961-21641983 AAACGTGCCTGCAGGGTCCTAGG + Intergenic
1182750211 22:32635562-32635584 ACAGATGCTTTCAAGGTCCCTGG + Intronic
1183281197 22:36933574-36933596 ACAGGTGGCTTCAGGGTTCTGGG + Intronic
952386163 3:32843100-32843122 GCAAGGGCTTCCAGGGTGCTGGG + Intronic
953750170 3:45602568-45602590 ACACCTGCTTTCAGGATCCCAGG - Intronic
954943966 3:54400548-54400570 GCAAAGGCTGTCAGGGTCCTTGG - Intronic
957238218 3:77622363-77622385 TCCAGTGCTCTCAGGGGCCTGGG - Exonic
957665427 3:83218933-83218955 CCCTGTGCTCTCAGGGTCCTGGG - Intergenic
958670616 3:97199048-97199070 ACAAGTACATTCAAGGTACTTGG - Intronic
963062652 3:141237296-141237318 AGAAGTCCTTTCAGGTTTCTGGG - Intronic
967497566 3:190158913-190158935 ACAAATGCTTTCAGGGTCTTTGG - Intergenic
967727356 3:192874018-192874040 AAAAGTACTTTCAGTGTGCTAGG - Intronic
967762051 3:193237321-193237343 ACAAGTGTTTACAGGATTCTTGG - Intergenic
968041956 3:195596239-195596261 ACAAATGCTTTGGGGGGCCTGGG - Intergenic
968382497 4:108198-108220 ACCAGTGTTTTCAGGATCCTTGG + Intergenic
968489419 4:882087-882109 ACAAGGGCTCGCGGGGTCCTCGG + Intronic
971417728 4:26448716-26448738 GCATTTGCTTTTAGGGTCCTAGG - Intergenic
971965436 4:33549306-33549328 ACAAATGCTTTTTGGGACCTTGG + Intergenic
973228633 4:47816662-47816684 ACATGTGCTTTGAGGCTCATTGG - Intronic
973533548 4:51857529-51857551 ATAAGTTGTTTCAGGGTCCTGGG + Intronic
977192413 4:94017507-94017529 ACTAGTGGTGTCAGGGTCCAAGG - Intergenic
977841083 4:101705891-101705913 TCAAGTGCTTTCAGGGTGTTAGG - Intronic
978369458 4:108015925-108015947 AGAACTGCTCTGAGGGTCCTTGG - Intronic
982069788 4:151685331-151685353 ACAGGTGCTGTCAGCCTCCTGGG - Intronic
983279716 4:165665228-165665250 AGAAGTGCTGTGATGGTCCTGGG - Intergenic
985846157 5:2350455-2350477 ACAAGTGTCCTCAAGGTCCTGGG - Intergenic
988946959 5:36213523-36213545 ACAAGTGCTCCAAGGGTACTTGG - Intronic
990809080 5:59701984-59702006 ACCAGTGCTTTCTTGGCCCTTGG - Intronic
991286138 5:64978307-64978329 ACAAGTGCTTTCAGGGTCCTAGG - Intronic
992178656 5:74175408-74175430 ACAAGTGATTTCTGGTTACTAGG - Intergenic
994683172 5:102915370-102915392 ACAAATGCTTTGACGGTACTTGG - Intronic
997312389 5:132898179-132898201 ACAGGCCCTCTCAGGGTCCTTGG - Intronic
997348263 5:133209750-133209772 CCAAGTGCTTACAGTGTGCTAGG - Intronic
1000555567 5:162721522-162721544 ACAAATGCTTTCATGGGCCAGGG - Intergenic
1001535711 5:172496631-172496653 CCAAGTGGCTTCAGGGTTCTGGG - Intergenic
1001588970 5:172852596-172852618 AAAAGGGCTTTCAGTGTCCTTGG - Intronic
1001929472 5:175662531-175662553 ACCAGTGCTTTGAAGGCCCTTGG - Intronic
1002171207 5:177375574-177375596 ACAACTCCTTCCAGGTTCCTGGG - Intergenic
1003053148 6:2797694-2797716 TCAAGGGATTTCAGGGACCTGGG - Intergenic
1003573672 6:7273711-7273733 TCAAATGCTTTGAGGGTCCCAGG + Intronic
1003837531 6:10087751-10087773 AGAATGGCTTTCAGTGTCCTGGG - Intronic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1006575938 6:35045889-35045911 AAAAGTGCTTTCAGGGTCGGTGG + Intronic
1012996382 6:105979834-105979856 ACAAGTCCCTTCACTGTCCTGGG - Intergenic
1013024511 6:106257443-106257465 ACAAGGGCTATCAGGTTACTAGG + Intronic
1018466440 6:164050765-164050787 ACAAGTTCTTTCATGCTCATGGG - Intergenic
1019064543 6:169285712-169285734 ACAAGTGGTTTCTGGTTCCATGG + Intergenic
1019484668 7:1284051-1284073 ACATCTGCTTTCAGGGGCCTAGG + Intergenic
1020612600 7:10419132-10419154 ACTTGTGCTCTCAAGGTCCTGGG - Intergenic
1024747000 7:52419295-52419317 ACAAGTGGTTTGGGGCTCCTTGG - Intergenic
1026598330 7:71752726-71752748 ACACTTGCTTTCCCGGTCCTCGG - Intergenic
1031077575 7:117227672-117227694 ACAAATGCTTTCAGAGTAATTGG + Intronic
1032839735 7:135704324-135704346 GCAACTGCCTTCAGGGTCTTTGG - Intronic
1033022056 7:137735463-137735485 ACCAGTATCTTCAGGGTCCTGGG - Intronic
1041421646 8:57673333-57673355 CCAAGTGCTTTCAGATTCTTAGG - Intergenic
1042985303 8:74576692-74576714 ACAAGTGCATACAGAGCCCTGGG + Intergenic
1045960905 8:107966653-107966675 AACAGTGCTTTCAGGGCACTTGG + Intronic
1049525796 8:143126313-143126335 ACAAGAGCTTGCAGCGTCTTGGG - Intergenic
1049881014 8:145063248-145063270 ACATGTGCTTTCATGTTTCTCGG + Intergenic
1050045680 9:1542349-1542371 ACAAGTGGTTTCTGGGTACATGG + Intergenic
1050631208 9:7560708-7560730 ATAAGTGTTTTCTGGGTCCTCGG + Intergenic
1050888051 9:10790392-10790414 ACCAGTGCTCTCAGGGGCCTGGG + Intergenic
1052835248 9:33245511-33245533 ACAGGTGCTTTCAGTGTGCCAGG - Intronic
1054324839 9:63707807-63707829 ACCAGTGATGTCAGCGTCCTCGG - Intergenic
1056597620 9:88020657-88020679 TCAAGTGGTTTCAGGGGCCAAGG - Intergenic
1057528366 9:95822588-95822610 ACAAGGGTTTTCAGAGTTCTTGG - Intergenic
1059431160 9:114251189-114251211 ACAAGTGCCTCCAAGGCCCTTGG - Intronic
1059696156 9:116732312-116732334 ACATGTGCTTAAGGGGTCCTGGG - Intronic
1060296766 9:122348365-122348387 ATAAATGCTTCCAGGTTCCTAGG - Intergenic
1060571546 9:124644795-124644817 GCTAGTGCTTGGAGGGTCCTTGG - Intronic
1186867102 X:13731650-13731672 ATGAGTGCTTTCTGGGTCCCTGG - Intronic
1186874052 X:13799656-13799678 ACGACTGCTTTCTTGGTCCTAGG + Intronic
1189669300 X:43390897-43390919 TCCATTGCTTTCAAGGTCCTGGG - Intergenic
1190049330 X:47137859-47137881 TGAAGTGCCTACAGGGTCCTAGG - Intergenic
1190817051 X:53938266-53938288 GCAGGTGCTTTCAGGTTTCTGGG + Exonic
1194434170 X:93849324-93849346 ACAACTGATTGCAAGGTCCTGGG - Intergenic
1195247978 X:103013840-103013862 CCAAGTGCTTTTTGGGTACTCGG - Intergenic
1195780451 X:108457188-108457210 ACAAATGCTTTCATTTTCCTTGG + Intronic