ID: 991290608

View in Genome Browser
Species Human (GRCh38)
Location 5:65030855-65030877
Sequence CCGGAAACGGCAGTGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991290608_991290620 24 Left 991290608 5:65030855-65030877 CCATCCACCACTGCCGTTTCCGG No data
Right 991290620 5:65030902-65030924 CCATCCGTCCAGATCCAGCAGGG No data
991290608_991290618 23 Left 991290608 5:65030855-65030877 CCATCCACCACTGCCGTTTCCGG No data
Right 991290618 5:65030901-65030923 TCCATCCGTCCAGATCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991290608 Original CRISPR CCGGAAACGGCAGTGGTGGA TGG (reversed) Intergenic
No off target data available for this crispr