ID: 991291431

View in Genome Browser
Species Human (GRCh38)
Location 5:65036920-65036942
Sequence TCCTTTTCCCACTTCATGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991291427_991291431 -8 Left 991291427 5:65036905-65036927 CCCCCTTCTCTAAAGTCCTTTTC No data
Right 991291431 5:65036920-65036942 TCCTTTTCCCACTTCATGAAAGG No data
991291429_991291431 -10 Left 991291429 5:65036907-65036929 CCCTTCTCTAAAGTCCTTTTCCC No data
Right 991291431 5:65036920-65036942 TCCTTTTCCCACTTCATGAAAGG No data
991291428_991291431 -9 Left 991291428 5:65036906-65036928 CCCCTTCTCTAAAGTCCTTTTCC No data
Right 991291431 5:65036920-65036942 TCCTTTTCCCACTTCATGAAAGG No data
991291426_991291431 5 Left 991291426 5:65036892-65036914 CCTTCTAATCTGTCCCCCTTCTC No data
Right 991291431 5:65036920-65036942 TCCTTTTCCCACTTCATGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991291431 Original CRISPR TCCTTTTCCCACTTCATGAA AGG Intergenic
No off target data available for this crispr