ID: 991294173

View in Genome Browser
Species Human (GRCh38)
Location 5:65063202-65063224
Sequence CTAGGTAAGCAGAGAGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991294173_991294178 11 Left 991294173 5:65063202-65063224 CCAGCATCTCTCTGCTTACCTAG No data
Right 991294178 5:65063236-65063258 ATGAGGGCAGCCACATCCTTAGG No data
991294173_991294179 12 Left 991294173 5:65063202-65063224 CCAGCATCTCTCTGCTTACCTAG No data
Right 991294179 5:65063237-65063259 TGAGGGCAGCCACATCCTTAGGG No data
991294173_991294176 -5 Left 991294173 5:65063202-65063224 CCAGCATCTCTCTGCTTACCTAG No data
Right 991294176 5:65063220-65063242 CCTAGAAAGACCAGACATGAGGG No data
991294173_991294180 17 Left 991294173 5:65063202-65063224 CCAGCATCTCTCTGCTTACCTAG No data
Right 991294180 5:65063242-65063264 GCAGCCACATCCTTAGGGTACGG No data
991294173_991294174 -6 Left 991294173 5:65063202-65063224 CCAGCATCTCTCTGCTTACCTAG No data
Right 991294174 5:65063219-65063241 ACCTAGAAAGACCAGACATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991294173 Original CRISPR CTAGGTAAGCAGAGAGATGC TGG (reversed) Intergenic
No off target data available for this crispr