ID: 991294741

View in Genome Browser
Species Human (GRCh38)
Location 5:65068771-65068793
Sequence GATTCAAATGGAGGACAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991294741_991294746 29 Left 991294741 5:65068771-65068793 CCCTCTTGTCCTCCATTTGAATC No data
Right 991294746 5:65068823-65068845 GACTTCAGTATCATGCAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991294741 Original CRISPR GATTCAAATGGAGGACAAGA GGG (reversed) Intergenic
No off target data available for this crispr