ID: 991295119

View in Genome Browser
Species Human (GRCh38)
Location 5:65072373-65072395
Sequence CTGAAGTCCCTCACATCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991295118_991295119 -8 Left 991295118 5:65072358-65072380 CCTCAGACTAAAATTCTGAAGTC No data
Right 991295119 5:65072373-65072395 CTGAAGTCCCTCACATCTTCTGG No data
991295115_991295119 3 Left 991295115 5:65072347-65072369 CCAATCCTGACCCTCAGACTAAA No data
Right 991295119 5:65072373-65072395 CTGAAGTCCCTCACATCTTCTGG No data
991295117_991295119 -7 Left 991295117 5:65072357-65072379 CCCTCAGACTAAAATTCTGAAGT No data
Right 991295119 5:65072373-65072395 CTGAAGTCCCTCACATCTTCTGG No data
991295116_991295119 -2 Left 991295116 5:65072352-65072374 CCTGACCCTCAGACTAAAATTCT No data
Right 991295119 5:65072373-65072395 CTGAAGTCCCTCACATCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991295119 Original CRISPR CTGAAGTCCCTCACATCTTC TGG Intergenic
No off target data available for this crispr