ID: 991298229

View in Genome Browser
Species Human (GRCh38)
Location 5:65103240-65103262
Sequence CGGCCGTCCCAGAACTTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991298229_991298240 25 Left 991298229 5:65103240-65103262 CCTGGAAAGTTCTGGGACGGCCG No data
Right 991298240 5:65103288-65103310 CGCCCCCGTCGTGCCCTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991298229 Original CRISPR CGGCCGTCCCAGAACTTTCC AGG (reversed) Intergenic
No off target data available for this crispr