ID: 991305965

View in Genome Browser
Species Human (GRCh38)
Location 5:65176359-65176381
Sequence GTTTATGTGCAAGTTGTATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991305963_991305965 0 Left 991305963 5:65176336-65176358 CCTCCTGAATGTAAAACAAAACA 0: 1
1: 3
2: 14
3: 197
4: 1432
Right 991305965 5:65176359-65176381 GTTTATGTGCAAGTTGTATAAGG No data
991305964_991305965 -3 Left 991305964 5:65176339-65176361 CCTGAATGTAAAACAAAACAGTT 0: 1
1: 0
2: 1
3: 47
4: 530
Right 991305965 5:65176359-65176381 GTTTATGTGCAAGTTGTATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991305965 Original CRISPR GTTTATGTGCAAGTTGTATA AGG Intronic
No off target data available for this crispr