ID: 991313226

View in Genome Browser
Species Human (GRCh38)
Location 5:65269487-65269509
Sequence CATTGTCACGGGAATCAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 58}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991313226 Original CRISPR CATTGTCACGGGAATCAAGT GGG (reversed) Intronic
906115177 1:43352077-43352099 CATGGTCAAGGCAATAAAGTTGG - Intronic
909302642 1:74032754-74032776 CATAGTCCTGGGAATCAAGGAGG + Intronic
913265551 1:117039861-117039883 CATTGTCAAGGGAACCGAGAGGG + Intergenic
916153378 1:161819037-161819059 CATTTTCACTGGAATAAATTTGG + Intronic
916235314 1:162581772-162581794 CTTTGTCACAGGAAAAAAGTTGG - Intronic
917634366 1:176920487-176920509 CACTGTAAGGGGAAACAAGTGGG - Intronic
1065598388 10:27341162-27341184 CACTGTCACGGACATCAAGCCGG + Intergenic
1081633859 11:44707722-44707744 CATTGCCATGGGAAGCAAGGAGG + Intergenic
1083244958 11:61419735-61419757 CATTGTGCTGGGAGTCAAGTAGG - Intronic
1099426481 12:82530187-82530209 CAATGTTACTGGAATCTAGTGGG - Intergenic
1101614614 12:106324367-106324389 CATTGTGACGGGAGTAGAGTTGG + Intronic
1111436123 13:88210557-88210579 CAATGGCAAGAGAATCAAGTAGG + Intergenic
1117639681 14:57785356-57785378 CATTGTCAGGGGAAGCAGGCAGG - Intronic
1117881695 14:60318988-60319010 CATTGTCAGGAGAAGCAAGAGGG - Intergenic
1119105595 14:71920382-71920404 CATTGTGAGGGGAGTCAAGATGG + Intergenic
1127072500 15:55300283-55300305 GACTGTCATGGGAAGCAAGTCGG + Intronic
1130913045 15:88284138-88284160 CATTGTCACGGAATTCAAACTGG + Intergenic
1131705805 15:94994352-94994374 CATTGTTATAGGAATAAAGTAGG + Intergenic
1132005175 15:98219951-98219973 CATTGTCACTGGAGTCATCTTGG - Intergenic
1134245251 16:12534871-12534893 CAGTGCCACGAGAATCTAGTGGG + Intronic
1148232598 17:45945853-45945875 TATTGTTAAGGGAATAAAGTAGG + Intronic
1156979495 18:43267643-43267665 CATAGGCAATGGAATCAAGTAGG - Intergenic
1158066575 18:53417393-53417415 CATTTTCAGTGGAAGCAAGTAGG - Intronic
1158427165 18:57351042-57351064 CTTTGTCACTGGAAACAAATAGG + Exonic
1158687915 18:59631428-59631450 CATTGTTTCTGGATTCAAGTCGG - Intronic
1161708729 19:5835058-5835080 CAGTGTCACGGGCATCCAGACGG - Exonic
1164707614 19:30332084-30332106 CATGGCCACGGGCATCAAATGGG + Intronic
926997974 2:18758779-18758801 CCTTGTCATGAGAATCAAATGGG + Intergenic
927996572 2:27491227-27491249 TATTTTCACAGGAAACAAGTAGG + Intergenic
1182775265 22:32826852-32826874 GGTTGTCACAGGGATCAAGTGGG - Intronic
1183518274 22:38280751-38280773 CATTGTCCCTGTCATCAAGTGGG + Intergenic
950111208 3:10419892-10419914 CATTGTCGCAGGGATCAAGCTGG - Intronic
955540050 3:59965726-59965748 TATAGTCATGGGAATCATGTAGG - Intronic
959883462 3:111473290-111473312 CATTCCCACTGGCATCAAGTTGG - Intronic
962571409 3:136716996-136717018 CATTGTCACAGGGATCAAATGGG + Intronic
968494327 4:907097-907119 CATTGTCAGTGGAATTGAGTCGG - Intronic
969955285 4:10883488-10883510 CGTTCTCAAGGGAATAAAGTTGG + Intergenic
975766292 4:77671211-77671233 CATTGTTATGGAAATCAAATGGG - Intergenic
978027511 4:103896266-103896288 GAGTGTCAGGGGAATGAAGTAGG - Intergenic
980423744 4:132597960-132597982 GATTGTTACTGGCATCAAGTGGG - Intergenic
981531741 4:145760911-145760933 CATTGTCAAGGGAATGAGATGGG + Exonic
984490122 4:180423821-180423843 CATTGTCAATAGAGTCAAGTGGG - Intergenic
990890911 5:60649091-60649113 CATAGTCGAGGGAATGAAGTGGG - Intronic
991313226 5:65269487-65269509 CATTGTCACGGGAATCAAGTGGG - Intronic
1001161744 5:169324108-169324130 CAGTGACATAGGAATCAAGTTGG - Intergenic
1001877366 5:175213176-175213198 CATTGTCTCAGGAAGCAACTGGG + Intergenic
1004311026 6:14544989-14545011 CATTCTCAAGGGAATCAGATTGG + Intergenic
1008381568 6:50843920-50843942 CATTGTTACGGGAATCTTCTGGG + Exonic
1010832420 6:80547140-80547162 CATTGTCACTGGAATGGAGGAGG - Intergenic
1021244963 7:18250162-18250184 CATTGTCATATGATTCAAGTTGG + Intronic
1021428442 7:20531026-20531048 CATTGACATGGGAAACACGTTGG + Intergenic
1033231814 7:139604110-139604132 CATGGTCTCGGGAATCACGGTGG + Exonic
1037903033 8:22699013-22699035 CATTCCCACGGGAATCAGGGAGG + Intergenic
1045722382 8:105128904-105128926 CATTGTCAAGGGGCTCACGTGGG - Intronic
1046754276 8:117956943-117956965 CATGGTCACGGGATTGAATTGGG - Intronic
1047065069 8:121272780-121272802 CATTGTCACTGGCATCACCTGGG + Intergenic
1055591541 9:77820146-77820168 CAATGTCACAAGAATCTAGTAGG - Intronic
1060015133 9:120080472-120080494 CACTGTCACCAGAATCAAGAAGG + Intergenic
1187827883 X:23350962-23350984 CATTTTCATGGGAATCCAGTAGG - Intronic
1187827890 X:23350992-23351014 TATTTTCATGGGAATCCAGTAGG + Intronic
1195130578 X:101847069-101847091 GATTGTCCTTGGAATCAAGTAGG + Intronic