ID: 991318187

View in Genome Browser
Species Human (GRCh38)
Location 5:65336445-65336467
Sequence GTATGGGTTCATGCAAAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 109}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991318187_991318196 13 Left 991318187 5:65336445-65336467 CCCCACTTTGCATGAACCCATAC 0: 1
1: 0
2: 0
3: 8
4: 109
Right 991318196 5:65336481-65336503 GCTTTGCAGGATGTATACTTAGG 0: 1
1: 0
2: 0
3: 8
4: 145
991318187_991318192 0 Left 991318187 5:65336445-65336467 CCCCACTTTGCATGAACCCATAC 0: 1
1: 0
2: 0
3: 8
4: 109
Right 991318192 5:65336468-65336490 AAAAACCCCACAAGCTTTGCAGG 0: 1
1: 0
2: 1
3: 31
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991318187 Original CRISPR GTATGGGTTCATGCAAAGTG GGG (reversed) Intronic
902153404 1:14463105-14463127 GGGTGGGTTAATGCAAATTGAGG + Intergenic
902260117 1:15218834-15218856 GGGTGGGTTAATGCAAATTGAGG - Intronic
905764939 1:40592499-40592521 GGGTGGGTTAATGCAAATTGAGG - Intergenic
906194135 1:43919513-43919535 GTATGGGTTGATCCCAAGTTCGG + Intronic
909773187 1:79451762-79451784 GTGTGGGATAATGCAAAGTTAGG - Intergenic
911483435 1:98474630-98474652 ATCTGGTTTCATACAAAGTGTGG - Intergenic
915467770 1:156107284-156107306 GCATGGGTTCCTACAAAGTCGGG - Intronic
916790961 1:168124805-168124827 CTATGAGCTCATGCAAAGTGTGG + Intronic
920278987 1:204829140-204829162 GCATGGGGTCATCCAAAGTGGGG - Intronic
1064131853 10:12716696-12716718 GTATGGCATCATGCAGAGAGTGG + Intronic
1072302339 10:94073404-94073426 GAATGGCTTCATGGAAAGTGGGG + Intronic
1072945750 10:99808614-99808636 ACATGGGTTTATGCAAAGGGAGG - Intronic
1076503708 10:130957540-130957562 TTGTGTGTTCATGCTAAGTGGGG - Intergenic
1077474146 11:2778491-2778513 GGATGGGTTCATGGGAAGAGAGG + Intronic
1078936081 11:15951309-15951331 GCATGGGATCATTCACAGTGGGG + Intergenic
1079537704 11:21534672-21534694 GCCAGGGATCATGCAAAGTGGGG + Intronic
1082083648 11:48031534-48031556 GATTGGGGTCATGCAAAATGGGG + Intronic
1088476435 11:110244471-110244493 GAATGGAATCATGCAAAATGTGG - Intronic
1090367384 11:126218328-126218350 TTGTGGATTCATCCAAAGTGAGG - Intronic
1093214703 12:16349013-16349035 ATGTGGTCTCATGCAAAGTGGGG - Intronic
1094475959 12:30840744-30840766 GGATGGGTCAATGCAAATTGAGG + Intergenic
1095879098 12:47113312-47113334 GTATATGTTCAAGAAAAGTGAGG - Intronic
1097987666 12:65801426-65801448 GTATGCTTTCATAGAAAGTGTGG + Intergenic
1099624643 12:85054429-85054451 GTATGTGTGCATGCAATGTTCGG + Intronic
1100541101 12:95558295-95558317 TGATGGGTTCACGTAAAGTGGGG - Intergenic
1101338146 12:103815269-103815291 GAATAGGATCATGCAACGTGTGG - Intronic
1105015571 12:132784799-132784821 GTATGTGTGCATGCAGTGTGAGG - Intronic
1105796262 13:23856509-23856531 GGGTGGGTTAATGCAAATTGGGG + Intronic
1106500379 13:30322674-30322696 GGAGGGGTTCCTGCAATGTGTGG - Intergenic
1107710543 13:43146373-43146395 GTTTGTGTTCAGGCAAAGGGAGG + Intergenic
1110723023 13:78786886-78786908 TTATCTGTTCATTCAAAGTGGGG - Intergenic
1110737297 13:78952133-78952155 GCATGTGTTCCAGCAAAGTGAGG - Intergenic
1112022133 13:95380718-95380740 GAGTGGGTTAATGCAAATTGAGG + Intergenic
1112751485 13:102588329-102588351 GGGTGGGTTAATGCAAACTGAGG + Intergenic
1115155561 14:30335130-30335152 GTTTGGGGTTGTGCAAAGTGGGG + Intergenic
1115155590 14:30335552-30335574 GTTTGGGGTTGTGCAAAGTGGGG - Intergenic
1115269457 14:31535646-31535668 GCAGGATTTCATGCAAAGTGTGG + Intronic
1116705425 14:48291481-48291503 ATATTGGTTCAGGCAAGGTGAGG + Intergenic
1118659943 14:67997290-67997312 ATATGGATTCAGGCAAAGTAGGG + Intronic
1120500198 14:85287831-85287853 GTAAGGGTTCCAGCAAAATGAGG + Intergenic
1120612708 14:86662101-86662123 ATATGGATATATGCAAAGTGAGG - Intergenic
1124569109 15:30844011-30844033 GAATGGGTTCAAGCAATGTTGGG - Intergenic
1125337721 15:38643719-38643741 TTATGGGTTCCTGCAACCTGGGG + Intergenic
1125925468 15:43559406-43559428 GAAGGGGTTCATGCAAATTTAGG + Intronic
1125938611 15:43658957-43658979 GAAGGGGTTCATGCAAATTTAGG + Intronic
1128609833 15:69064814-69064836 GGAGGGGTGCATGCAAGGTGGGG - Intergenic
1128967447 15:72073544-72073566 GTATTTGTTCAATCAAAGTGTGG - Intronic
1130314037 15:82779914-82779936 GTCTGGGTCCAGGCATAGTGGGG + Intronic
1137511605 16:49105635-49105657 GTATGTTTTCATGCAAAGCAGGG + Intergenic
1140296920 16:73717864-73717886 GGAGGGCTGCATGCAAAGTGTGG - Intergenic
1140355695 16:74304027-74304049 CTGTGCGTTCATGCCAAGTGTGG + Intronic
1142094441 16:88231994-88232016 GCCTGGGTCCATGCAGAGTGTGG - Intergenic
1142158017 16:88541555-88541577 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1149662026 17:58339050-58339072 GTCTGGATTCATGGAAGGTGAGG - Intergenic
1151202593 17:72479586-72479608 GAATGAGTTCAAGCAGAGTGGGG - Intergenic
1155056918 18:22193046-22193068 GTATGGGTTGGGGCAGAGTGGGG + Intronic
1156272096 18:35545089-35545111 GTCTGGGTTCAGCCAAAGGGAGG + Intergenic
1158918707 18:62165166-62165188 GAATGGGTTGTTGTAAAGTGAGG + Intronic
1159108474 18:64029312-64029334 GAGTGGGTTAATGCAAATTGAGG + Intergenic
1162548127 19:11343251-11343273 GTCTGGGTTCAAGGAAAGAGGGG - Intronic
926706696 2:15842622-15842644 GTGTGGGTCCCTGCAGAGTGGGG - Intergenic
926786004 2:16519167-16519189 GTATGGGGTGATGCAAACTATGG - Intergenic
928235874 2:29539128-29539150 TTATAGGTTGATGCTAAGTGTGG + Intronic
928740655 2:34348198-34348220 GTATGGTATAATCCAAAGTGAGG - Intergenic
929123660 2:38503662-38503684 GTAGGGGTTGAGGCAGAGTGGGG - Intergenic
931669622 2:64635839-64635861 GCAAGGGTGCATGCACAGTGTGG + Exonic
934740834 2:96721214-96721236 GCATGGGATCATACAATGTGTGG + Intronic
935740446 2:106142874-106142896 GTATGACTTCATTCAATGTGTGG + Intronic
936012951 2:108936619-108936641 GTCTGGGTTGATGGGAAGTGGGG - Intronic
938048655 2:128146979-128147001 CTACGGGTTGATGCACAGTGGGG - Intronic
943937079 2:193933552-193933574 GTATGGCTTCATGCAAATACAGG + Intergenic
944280720 2:197893477-197893499 GTTAGGGTTTATTCAAAGTGAGG + Intronic
949078716 2:242079423-242079445 GGATGGATTCATGCCAACTGGGG - Intergenic
1171510083 20:25675169-25675191 GTATTCTTTCATGCACAGTGAGG + Exonic
1172424372 20:34845276-34845298 CTCTGGGAACATGCAAAGTGGGG + Exonic
1173463599 20:43263375-43263397 GGAGGGGGTAATGCAAAGTGGGG - Intergenic
1174706651 20:52663301-52663323 ATCTGGGATCATGCAAAGTATGG - Intergenic
1179939806 21:44629941-44629963 GGATGGGTGCAGGGAAAGTGGGG + Intronic
1181077150 22:20387989-20388011 GTGTGGGTTGAGGCAGAGTGGGG + Intronic
1181667455 22:24407971-24407993 CTCTGGGATCATTCAAAGTGAGG - Intronic
949141869 3:643712-643734 GTAGGGTATCATGCAATGTGTGG + Intergenic
950216448 3:11163165-11163187 GGATGGGGTGATGCACAGTGGGG - Intronic
953168275 3:40484521-40484543 GTATTGATTAAGGCAAAGTGGGG - Intronic
957467346 3:80610727-80610749 ATATGGTTTTATGCAAAGTGTGG + Intergenic
958558677 3:95713347-95713369 ATATGGGCTCATACAAGGTGAGG + Intergenic
962811099 3:138960323-138960345 GTATGTGTTCATGGATAGTGAGG + Intergenic
970277087 4:14412880-14412902 GTATGGGTTCTTACAGATTGTGG - Intergenic
974775588 4:66476557-66476579 ATGTGTGTTCATGAAAAGTGGGG - Intergenic
977076182 4:92453405-92453427 GAATGGGTTCATACAGAGTATGG + Intronic
980394592 4:132193395-132193417 GTATGGTTTTATGCACTGTGTGG + Intergenic
984101051 4:175486368-175486390 TTATGGGTTCATGAAAAGTCAGG - Intergenic
984844851 4:184100559-184100581 GTGTGCGTTCAGGCAGAGTGGGG + Intronic
986114768 5:4761863-4761885 GTGTGGGTTCATGGAAAGCCTGG - Intergenic
991318187 5:65336445-65336467 GTATGGGTTCATGCAAAGTGGGG - Intronic
994367773 5:98934805-98934827 GTAAGGCTTCATGGAAAGAGTGG + Intergenic
1003463440 6:6353540-6353562 GTCTGTGTTCATGCTGAGTGGGG + Intergenic
1008002132 6:46371536-46371558 GAATTGATTCATGCTAAGTGAGG + Intronic
1009370476 6:62894376-62894398 GTGTGGATTAATGCAAATTGAGG + Intergenic
1010675913 6:78742752-78742774 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1013091607 6:106905425-106905447 TTATAGGTTCAAACAAAGTGTGG - Intergenic
1013608234 6:111770779-111770801 GTTAGGGTTCTTCCAAAGTGAGG - Intronic
1016628822 6:146203434-146203456 GTAGGAGTGCATGCAAAGTGAGG + Intronic
1018087727 6:160319438-160319460 GTAATGGTCCATGCCAAGTGAGG + Intergenic
1018977254 6:168574868-168574890 GTTCTGGTTCATGCAAAGGGCGG - Intronic
1020330503 7:7012509-7012531 GAATGGTGTCTTGCAAAGTGGGG - Intergenic
1021979863 7:26043895-26043917 GTATGGGGGAATGTAAAGTGAGG + Intergenic
1024321146 7:48071224-48071246 GTATGGGGTAATGCAAAGGCTGG - Intergenic
1024747671 7:52427161-52427183 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1029966316 7:104744599-104744621 GAATGAGTTCATGAAAAGAGTGG - Intronic
1030144379 7:106338766-106338788 GCATGGATTCATGGAAAATGAGG + Intergenic
1032906607 7:136374714-136374736 GAAAGGGTTCATGCAATGAGGGG + Intergenic
1035536982 8:399444-399466 GGATGGATTCATGCCAACTGGGG - Intergenic
1040356578 8:46624346-46624368 GAATGGCTTCTTGCAAAGTGTGG - Intergenic
1042921689 8:73926236-73926258 GAATTGGCTCATGCAATGTGGGG - Intergenic
1051383804 9:16485500-16485522 GACTGGGTTAATGCAAAGTTGGG - Intronic
1190322583 X:49187431-49187453 GGATGGGGTCAGGCAATGTGAGG + Intergenic
1193453889 X:81705123-81705145 ATATGGTTTCTTGCACAGTGTGG + Intergenic
1195373931 X:104207065-104207087 GGGTGGGTTAATGCAAATTGAGG + Intergenic