ID: 991321917

View in Genome Browser
Species Human (GRCh38)
Location 5:65383622-65383644
Sequence CACAGGCACATGACTACAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 141}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991321917_991321921 -8 Left 991321917 5:65383622-65383644 CCAATTGTAGTCATGTGCCTGTG 0: 1
1: 0
2: 0
3: 7
4: 141
Right 991321921 5:65383637-65383659 TGCCTGTGGCTCTCCCGGGCTGG 0: 1
1: 4
2: 22
3: 70
4: 307
991321917_991321926 23 Left 991321917 5:65383622-65383644 CCAATTGTAGTCATGTGCCTGTG 0: 1
1: 0
2: 0
3: 7
4: 141
Right 991321926 5:65383668-65383690 TTTGATTCCTCTACTGCTCTGGG No data
991321917_991321929 30 Left 991321917 5:65383622-65383644 CCAATTGTAGTCATGTGCCTGTG 0: 1
1: 0
2: 0
3: 7
4: 141
Right 991321929 5:65383675-65383697 CCTCTACTGCTCTGGGGTGTTGG 0: 1
1: 0
2: 1
3: 12
4: 179
991321917_991321927 24 Left 991321917 5:65383622-65383644 CCAATTGTAGTCATGTGCCTGTG 0: 1
1: 0
2: 0
3: 7
4: 141
Right 991321927 5:65383669-65383691 TTGATTCCTCTACTGCTCTGGGG No data
991321917_991321925 22 Left 991321917 5:65383622-65383644 CCAATTGTAGTCATGTGCCTGTG 0: 1
1: 0
2: 0
3: 7
4: 141
Right 991321925 5:65383667-65383689 CTTTGATTCCTCTACTGCTCTGG 0: 1
1: 0
2: 1
3: 6
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991321917 Original CRISPR CACAGGCACATGACTACAAT TGG (reversed) Intronic
902017748 1:13321834-13321856 GAGAGGCACAAGACTATAATTGG - Exonic
904163584 1:28538392-28538414 AAGGGGCACATGACTAGAATGGG - Intronic
904820270 1:33238455-33238477 CACGGTCACATGACTCAAATGGG - Intergenic
910091669 1:83471777-83471799 CACACACACATGACTAGAAGAGG + Intergenic
912713275 1:111964542-111964564 CACAGCCAGGTGACCACAATGGG + Intronic
913108831 1:115640414-115640436 TTCAGGTACATGACTAGAATTGG + Intergenic
916972674 1:170041540-170041562 CACAGGCAGATGCCTACGAGGGG - Intronic
919554540 1:199033988-199034010 CACAGGCCTGTGACTATAATGGG - Intergenic
920702074 1:208225450-208225472 CACAGGCACCTGTCTACACCTGG + Intronic
921729811 1:218565335-218565357 AAGAGGCACATGAGTTCAATTGG - Intergenic
922655338 1:227377477-227377499 CACAGGCACAGGAATGAAATTGG - Intergenic
922719773 1:227894311-227894333 CACAAGCACACAACCACAATAGG + Intergenic
1067279200 10:44858529-44858551 CTCAGGTACATGACTGCTATGGG + Intergenic
1068168099 10:53357602-53357624 GATAAGCACATTACTACAATAGG + Intergenic
1069123331 10:64597235-64597257 CACATGCAAATGACTGCAGTTGG - Intergenic
1069561161 10:69430685-69430707 CACAAGTACATGACTACTTTTGG + Intergenic
1070412317 10:76153512-76153534 CACATGCAAAAGACTACATTTGG - Intronic
1072550630 10:96474550-96474572 CACAGGCACATCATTGCATTTGG + Intronic
1073164410 10:101432266-101432288 TACAGGCACACGACCACACTTGG + Intronic
1074022847 10:109602227-109602249 CCCAGGCACCTGATTACAATTGG + Intergenic
1074522083 10:114235243-114235265 CACAGTCACTTTACTACAATGGG + Intergenic
1077362508 11:2146947-2146969 CGCAGGCTCCTGACCACAATGGG + Intronic
1077711021 11:4537100-4537122 AACAGACACATGAAAACAATTGG + Intergenic
1079502610 11:21118516-21118538 CACAGGCAAATGACCACTAAGGG - Intronic
1079929264 11:26537597-26537619 CACAGCCACAAAATTACAATGGG - Intronic
1080321416 11:31014385-31014407 CACAGTCACATGAATAAACTTGG + Intronic
1081011239 11:37814742-37814764 CACAGGCACATATCTGCAAATGG + Intergenic
1084380026 11:68805864-68805886 CCCAGGGCCATGACTACAATGGG + Intronic
1084564047 11:69919635-69919657 CACATGAACATGAGTGCAATGGG + Intergenic
1085384140 11:76147056-76147078 CCCAGGCACAGAACTACAAGGGG + Intergenic
1086928327 11:92665377-92665399 CAGATGAACATGACTACAGTTGG - Intronic
1089160615 11:116434277-116434299 CACAGGCACATGCCATCAAGGGG + Intergenic
1090262489 11:125331509-125331531 CACAGGCACCTGTCCACACTTGG + Intronic
1091182819 11:133622197-133622219 CACAGGGACATGACCAGATTTGG - Intergenic
1093137837 12:15473280-15473302 CAGAGGCACATGAGTAAGATGGG - Intronic
1093664881 12:21800182-21800204 CACAGGCAAGTGACTTCATTTGG - Exonic
1100821459 12:98435284-98435306 CACATGCAGAAGAATACAATTGG + Intergenic
1101485872 12:105159081-105159103 TTCAGGCACATGACTTCAAATGG - Intronic
1105427167 13:20303774-20303796 TGCAGGCAAATGACTACTATGGG - Intergenic
1105442363 13:20425985-20426007 CACAGGCTCATGACTCCTAAAGG + Intronic
1106924188 13:34595966-34595988 CAAAAGCAGATGACCACAATGGG + Intergenic
1109900636 13:68764624-68764646 CACATGCAGAAGAATACAATTGG + Intergenic
1111652406 13:91108465-91108487 CAGAGGCACATGAGAACAAGTGG - Intergenic
1115819893 14:37202707-37202729 CAGAAGCTAATGACTACAATTGG - Intronic
1116776218 14:49183939-49183961 CACAGGCAGAAGAATAAAATTGG + Intergenic
1117155955 14:52941752-52941774 CAAAGGCACATGAAAACATTGGG - Intronic
1118785071 14:69038840-69038862 CACGAGCACATGCCTACCATGGG - Intergenic
1120266433 14:82257030-82257052 CAGAGACGCAGGACTACAATAGG - Intergenic
1122002980 14:98679095-98679117 CACAGGCAAAAGAATAAAATAGG + Intergenic
1125144316 15:36448921-36448943 CACTGGGAGATCACTACAATAGG + Intergenic
1131158716 15:90090684-90090706 CTCAGGGACATGACAACAAAGGG + Intronic
1139631042 16:68232086-68232108 CACAGGCACATCACTAGAGGTGG - Exonic
1139941704 16:70610318-70610340 AACAGGCACAAGACTAGGATGGG - Intronic
1147322609 17:39655324-39655346 CACAGGTGCATGACCACATTTGG + Intronic
1149311170 17:55395509-55395531 CTCAGGCACCTGATTAGAATGGG + Intronic
1150824591 17:68463421-68463443 AACAGGCACATGATAAAAATTGG - Intergenic
1158212266 18:55064942-55064964 CACACGCACATCACGACATTTGG - Intergenic
1158395837 18:57077878-57077900 CACCTGCACATGACTATCATGGG - Intergenic
1159762651 18:72448062-72448084 TACAGGCACATGCCCACATTCGG + Intergenic
1161105923 19:2444005-2444027 CACAGGGAAATGCCTACGATGGG + Intronic
1161185328 19:2914830-2914852 CAAAGGGACATGACTACAGATGG - Intronic
1165241400 19:34471173-34471195 AAAGGGCACATGAATACAATAGG - Exonic
1165725662 19:38110846-38110868 GACAGGCACACGACTCCAACTGG - Intronic
1168497692 19:56867746-56867768 AATGGGCACATGACTCCAATGGG + Intergenic
928125627 2:28613786-28613808 CACAGACCCCAGACTACAATGGG + Intronic
940151098 2:150601648-150601670 AGCAGGCACATAACTGCAATCGG - Intergenic
942697907 2:178666661-178666683 CACTGGGACATGAATACATTTGG + Intronic
943008282 2:182413780-182413802 CACAGACACAGGATTACAAGAGG - Intronic
944976503 2:205059126-205059148 CACAGGCAAATGACTGAAGTTGG - Intronic
946738722 2:222780497-222780519 CACAGGCAGAAGACAACCATGGG + Intergenic
947223650 2:227819510-227819532 CACAAGCACATGGCTAGATTAGG + Intergenic
1170786316 20:19470613-19470635 CACATAGACATGACTACTATTGG + Intronic
1171206351 20:23284163-23284185 TGCAGGCACATGAATAGAATTGG - Intergenic
1174115477 20:48223905-48223927 CACAGACATGTGACCACAATGGG - Intergenic
1174165137 20:48578913-48578935 CACAGACATGTGACCACAATAGG + Intergenic
1177277601 21:18933811-18933833 AAAAGGCAAATGACTACAACAGG + Intergenic
1177405461 21:20662187-20662209 CACAGGCTAAAGAGTACAATGGG + Intergenic
1178017139 21:28360636-28360658 CACAGGCAAAAGAATAGAATTGG - Intergenic
1179614882 21:42576252-42576274 CACTGGCACAGGAAGACAATGGG + Intronic
1182973979 22:34605200-34605222 CACAGCCACATGGCTACAGTTGG - Intergenic
1183523532 22:38310401-38310423 CACAGACACATGGACACAATCGG + Intronic
950192605 3:10988131-10988153 AACAGGCACATGCCTCCAAATGG - Intergenic
953843654 3:46409904-46409926 CACCAGCACATAACTACAAAAGG + Intronic
956670213 3:71682119-71682141 CACAGGCACTTGCCTACATTGGG - Exonic
959369829 3:105509523-105509545 AACAGGCACATGACCTGAATAGG - Intronic
959590412 3:108073915-108073937 CAAAGGAAGATGACTAGAATGGG + Intronic
965274243 3:166660295-166660317 CACATGCAAAAGAATACAATTGG + Intergenic
966240954 3:177754824-177754846 CAAAGCCACATAACTACAAGTGG + Intergenic
967498903 3:190175032-190175054 CACAGTCTCATGCCTATAATAGG - Intergenic
971037145 4:22706097-22706119 GGCAGGTACATGACTACAGTAGG + Intergenic
976382737 4:84418747-84418769 CACAGGTACATAAATACCATCGG + Intergenic
977874149 4:102129447-102129469 CCCAGGCAGAAGACTACCATGGG + Intergenic
978427821 4:108600789-108600811 CACATGCAAATGATTCCAATGGG - Intergenic
979697449 4:123629498-123629520 CAGAGGCATATGAATAGAATAGG - Intergenic
983421391 4:167522466-167522488 AACAGACAAATGATTACAATAGG + Intergenic
987614282 5:20252515-20252537 CACAGGTAAATGATTATAATAGG + Intronic
988128263 5:27072076-27072098 CACAGTCACATGACTAAATCTGG + Intronic
988292948 5:29314546-29314568 CAAAGGCACATGACAGAAATAGG + Intergenic
988372055 5:30383205-30383227 CACAGCCAGATGACTATACTGGG + Intergenic
991321917 5:65383622-65383644 CACAGGCACATGACTACAATTGG - Intronic
991439108 5:66627787-66627809 CACAGTCACATGACTTAACTGGG - Intronic
993254268 5:85567935-85567957 CCCAGACACATGACAATAATTGG - Intergenic
994002869 5:94801901-94801923 AAGAGGAAGATGACTACAATGGG - Intronic
997335614 5:133107108-133107130 CTCAGACACGTGGCTACAATAGG - Intergenic
1000808036 5:165821978-165822000 CACATGCAAATGAATAAAATTGG - Intergenic
1003339261 6:5204148-5204170 CACAGGCCCAGGAGTACAACAGG - Intronic
1005266278 6:24115562-24115584 CTCAGTCACATCCCTACAATGGG + Intergenic
1007084161 6:39131505-39131527 CAGACGCACATGACAACACTTGG - Intergenic
1007741894 6:44016619-44016641 CTCAGACACATGACTATATTTGG + Intergenic
1008438049 6:51499097-51499119 CACAGTCACATGAGTACACAAGG - Intergenic
1016087027 6:139926918-139926940 CACAGGATCATGACTAAAAGTGG + Intergenic
1019183818 6:170209385-170209407 CACAGGCACCTGCATACAATTGG + Intergenic
1021488809 7:21196407-21196429 AGCAGGCCCATGACCACAATGGG + Intergenic
1021940057 7:25670162-25670184 CTCAGGCACAGGATTACAAGTGG - Intergenic
1023273445 7:38492195-38492217 CACAGCCACATGACCACACCTGG - Intronic
1023836564 7:44072151-44072173 GAGAAGCACATGACCACAATAGG + Intergenic
1024143790 7:46490006-46490028 TACAGTCACATGAACACAATGGG - Intergenic
1027308520 7:76928229-76928251 CACACACACATGACTAGAAGAGG + Intergenic
1029956353 7:104644416-104644438 CACAGGCACATAAATATTATTGG + Intronic
1033498082 7:141919669-141919691 CGCAGGCAGCTGATTACAATTGG + Exonic
1034731619 7:153392146-153392168 CACAGGCACAAGAGAACCATAGG + Intergenic
1034854136 7:154524723-154524745 CTCAGACACAGGACTAGAATTGG - Intronic
1035033503 7:155880262-155880284 CACAGGCACATTACTGCAAGAGG - Intergenic
1036564486 8:9926713-9926735 CACAGGCACATGGTTACATAGGG - Intergenic
1041584426 8:59499316-59499338 CACAGACACAGGACCACAAGGGG - Intergenic
1041828996 8:62131163-62131185 CACAGACACATGAATCCAAAGGG - Intergenic
1042598765 8:70477316-70477338 CACAGGCCCATGTGTAAAATGGG - Intergenic
1043614902 8:82113658-82113680 CACATGCAAAAGAATACAATGGG + Intergenic
1046179398 8:110623898-110623920 GACAGGCACATGACAAAAAAAGG - Intergenic
1049615191 8:143572852-143572874 CACACGGACGTGCCTACAATGGG + Exonic
1051113670 9:13669487-13669509 CACATGCAAATGAATAAAATTGG + Intergenic
1055186065 9:73455504-73455526 CACAGGAACATGGGAACAATTGG - Intergenic
1056408511 9:86300837-86300859 CACAGGCACATGCATAGAAAAGG - Intronic
1057000747 9:91506673-91506695 CACAGGGACATTACTGCCATAGG - Intergenic
1057730488 9:97604256-97604278 CACAGGTACATTAATACAACTGG + Intronic
1059779932 9:117515608-117515630 TACAGCCACCTGACTTCAATTGG - Intergenic
1061442445 9:130615300-130615322 CAAAGGCTCAAGACTACAAAAGG + Intronic
1062515289 9:136930869-136930891 CACAGGCACACCACCACACTCGG + Intronic
1062653009 9:137587972-137587994 CACAGGCACATGGCTCCCAGGGG + Intronic
1190978703 X:55434239-55434261 CTCAGACACATGTCTACAAGAGG + Intergenic
1193110685 X:77726668-77726690 CACATTCACATAACTACAAAAGG + Intronic
1194113010 X:89859693-89859715 CACATGCAAATGAATAAAATGGG - Intergenic
1195675291 X:107503070-107503092 CACAGGCACATAGCTACCACTGG + Intergenic
1197839711 X:130732821-130732843 CACATGCAAAAGAGTACAATTGG + Intronic
1197992003 X:132328712-132328734 CACAGGCACAAGACTCTACTTGG - Intergenic
1199573946 X:149294939-149294961 CAGAGCCACATGGCTACTATTGG - Intergenic
1200465662 Y:3514523-3514545 CACATGCAAATGAATAAAATGGG - Intergenic
1200528926 Y:4309784-4309806 CACAGGCAGAAGAATAAAATTGG + Intergenic
1200879879 Y:8201877-8201899 CTAAGGCACATGACAACAAAAGG - Intergenic