ID: 991327203

View in Genome Browser
Species Human (GRCh38)
Location 5:65448398-65448420
Sequence ATTTTGTCCCAGGGACTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 163}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991327203_991327209 19 Left 991327203 5:65448398-65448420 CCTTTGAGTCCCTGGGACAAAAT 0: 1
1: 0
2: 0
3: 7
4: 163
Right 991327209 5:65448440-65448462 CATATCCATCATTTTTCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991327203 Original CRISPR ATTTTGTCCCAGGGACTCAA AGG (reversed) Intronic
900503835 1:3019414-3019436 ATCCTGTCCCAGGGCTTCAAAGG + Intergenic
903337972 1:22637529-22637551 ATTGTGTGCATGGGACTCAAGGG + Intronic
904596886 1:31652410-31652432 TTTTTGTTCCTGGGACTAAACGG + Exonic
904908686 1:33917609-33917631 ATTATGTCCCAGTGTCTGAAGGG - Intronic
904912963 1:33949261-33949283 ATCTTCTCCCAGGGAATCCAGGG - Intronic
905540589 1:38757321-38757343 ATTCAGCCCCAGGGAATCAAGGG + Intergenic
907181832 1:52577481-52577503 ATTTTGTCCAGGGAACTGAAGGG - Intergenic
908406469 1:63818946-63818968 TTTTTGTTCCAGGGTCTCAGTGG + Intronic
908574742 1:65447653-65447675 CTGTAGTCCCAGGTACTCAAGGG - Intronic
910487842 1:87735486-87735508 ACTTACTTCCAGGGACTCAATGG - Intergenic
910631234 1:89356887-89356909 ATTTTGCCCCAGTGACTCTGTGG - Intergenic
913328209 1:117646252-117646274 ATTTAGTCTCAGGGGCACAATGG + Intergenic
914919345 1:151837201-151837223 ATAATGTCCCAGGGATTGAAAGG - Intergenic
915457091 1:156048231-156048253 TTCTTGTACCAGGGGCTCAAAGG - Intronic
916487038 1:165269120-165269142 CTTTTGTCCCAGAGCCTCCAAGG - Intronic
918173671 1:182023520-182023542 ATTTACTCCCAGGGACACCAAGG + Intergenic
919571832 1:199258558-199258580 CTTTTGTCCCACGGAGTCACTGG + Intergenic
920243234 1:204569082-204569104 AGTTTGTGTCAGGGACTCACTGG - Intergenic
920708221 1:208270837-208270859 ATGTTCTCCCAGTGACTCCATGG + Intergenic
923660646 1:235954476-235954498 CTGTAGTCCCAGTGACTCAAGGG + Intergenic
923688413 1:236170211-236170233 ATTTTGACCCAAGGAGGCAATGG - Intronic
924011683 1:239672021-239672043 ATTTTATCCCAGAGAATGAAAGG + Intronic
924736722 1:246763697-246763719 ATTATGTCTCAGGGCCTCAATGG + Intronic
1064256105 10:13743903-13743925 GATTTGTAGCAGGGACTCAAGGG + Intronic
1069167012 10:65173589-65173611 ATTTTGTCCCCGCTATTCAAAGG + Intergenic
1073435064 10:103511246-103511268 AGTCTGTCCCAGGGACACAGGGG + Intronic
1074452225 10:113568481-113568503 ATTCTGTCCCAGGTGCTCAGAGG + Intronic
1075191297 10:120311495-120311517 CTTTTGTCCCAAGAACTAAAAGG - Intergenic
1075531553 10:123234460-123234482 ATCTTGTTCCAGGGATTCCAAGG - Intergenic
1076526215 10:131113750-131113772 ATTTTGACTTAGGGACTCAGGGG - Intronic
1078395164 11:10974623-10974645 TTTTTCTCCCAGGTAGTCAAAGG - Intergenic
1080339087 11:31236799-31236821 ATTTTGTTCCAAGGTTTCAAAGG + Intronic
1081956763 11:47099338-47099360 CATTTGTGCCAGGGACTAAATGG - Intronic
1083940612 11:65893444-65893466 ATTTTCTCCCAGGGGCTTATGGG - Intronic
1090998031 11:131884774-131884796 GTTTTGTCCCAGGAACCCACAGG - Intronic
1092728348 12:11506065-11506087 ATTTTCTGGCAGGGACACAAAGG + Intergenic
1094820483 12:34220298-34220320 CTTTAGTCCCAGGTACTCGAGGG - Intergenic
1098548482 12:71737385-71737407 ATTTAGTCTCAAAGACTCAAGGG + Intergenic
1101883737 12:108643804-108643826 ATTTTGTCCCAGGGAACTAGTGG - Intergenic
1103017965 12:117510547-117510569 ACTGTATCACAGGGACTCAATGG - Intronic
1103879274 12:124153587-124153609 ATTTTGTACCAGCGAAGCAATGG + Intronic
1107098381 13:36560953-36560975 TTTTTGTCCCAGTGCCTCAAGGG - Intergenic
1109106748 13:58262270-58262292 ATTTCATCCCAGAGATTCAAGGG + Intergenic
1112122112 13:96424480-96424502 ATTTTGTTACAGCAACTCAAAGG - Intronic
1113678607 13:112226099-112226121 ATGTGGCCCCAGGGACTCATGGG + Intergenic
1114199930 14:20510600-20510622 ATTTTGGTCCAGTGACTCACAGG + Exonic
1115341128 14:32293978-32294000 ATTTTGTCCCAGGGAGAACACGG + Intergenic
1115822207 14:37224617-37224639 ATGTTGTAGGAGGGACTCAATGG - Intronic
1116937922 14:50761155-50761177 AATGTAACCCAGGGACTCAAAGG + Intronic
1120920442 14:89750350-89750372 ATTATGTGCCAGGCACTCATGGG + Intergenic
1125168481 15:36738892-36738914 ATTATGTGCCAGGCACTGAATGG + Intronic
1127011102 15:54629564-54629586 ATTTTGTTCATGGGACTAAACGG - Exonic
1127034606 15:54901617-54901639 ATTCTGTGCCAGCTACTCAATGG + Intergenic
1128859758 15:71058032-71058054 ATATTGTCCCAGAGTCTCACAGG + Intergenic
1129018450 15:72490803-72490825 GTTTAGTCACTGGGACTCAAAGG - Intronic
1130051299 15:80486153-80486175 ATTTGGACCCAGAGACACAAAGG - Intronic
1135156568 16:20057961-20057983 ACTTTGTGCCAGGGACTACAGGG - Intronic
1138943778 16:61822493-61822515 AGTTTATCCAAGGGACTCAGTGG - Intronic
1139738062 16:69009856-69009878 ATTTGGTGGCAGGAACTCAAGGG + Intronic
1140604605 16:76519658-76519680 ATTTTGTCCTAGAGATCCAAAGG + Intronic
1141106690 16:81239703-81239725 ATTTTCTCTCAGGAACTCACAGG + Intronic
1141419917 16:83907611-83907633 ATGTTGTCCCATGGAATCCATGG + Intronic
1144628773 17:16858951-16858973 ATTGTGTCCCAGAGCTTCAAAGG - Intergenic
1144652633 17:17017142-17017164 ATTGTGTCCCAGAGCTTCAAAGG + Intergenic
1144733203 17:17540435-17540457 ATTATGTCCCAGGGGGTCAGGGG + Intronic
1145102347 17:20087679-20087701 ATTATGTGCCAGGAACACAATGG + Intronic
1145160346 17:20569524-20569546 ATTGTGTCCCAGAGCTTCAAAGG - Intergenic
1145412175 17:22677239-22677261 TTTTTGTCCCTAGGCCTCAATGG + Intergenic
1151194910 17:72424567-72424589 TTTGTGTCCCAGGCACACAATGG - Intergenic
1153416060 18:4847064-4847086 ACTTTCTCCCAGGATCTCAAAGG - Intergenic
1155629366 18:27874023-27874045 ATTTTGTCCCAGACACTACATGG + Intergenic
1159449664 18:68584216-68584238 ATTTTTTCCCTAGGACTGAATGG + Intergenic
1159543343 18:69809101-69809123 GATTTATCCCAGGGATTCAAGGG + Intronic
1160138147 18:76292432-76292454 AATTTATCCCAGGGATGCAAGGG - Intergenic
1160298113 18:77656007-77656029 CTTTTGTCCCAGTTAGTCAAGGG - Intergenic
1160729946 19:637058-637080 AATTTGTCACAGGGGCTCCAGGG - Intergenic
1164642350 19:29835618-29835640 ATTTTGTGCCAGGAAGGCAATGG - Intergenic
1164803824 19:31100504-31100526 ATTTCATCCCAGGGACTACAAGG - Intergenic
1164896676 19:31882946-31882968 ATTTTGTCCCAGAGATGCAGTGG - Intergenic
926341870 2:11910440-11910462 ATTTTGTTCATGGGACACAAAGG - Intergenic
929129514 2:38553324-38553346 TTTTTTTCCCAGGAACTCACTGG - Intergenic
929131427 2:38577564-38577586 ATTTTGACCCAAGTACTTAATGG + Intronic
930458963 2:51644931-51644953 ATTTCATCCCAGGGATGCAAGGG - Intergenic
931590565 2:63878684-63878706 CTATAGTCCCAGGTACTCAATGG - Intronic
936087239 2:109477580-109477602 ATTTTGTTACAGCAACTCAAGGG - Intronic
939518332 2:143198289-143198311 TATTTGTACCATGGACTCAATGG + Intronic
940145127 2:150537955-150537977 ATCTTGTCCCAGGGAGTTGAGGG - Intronic
942324217 2:174761765-174761787 ATCAAGTCCCAGGGGCTCAATGG - Intronic
942530657 2:176906360-176906382 TTTTTTTCCCAGGGAAACAATGG - Intergenic
942573570 2:177338621-177338643 ATTTTGACCCAGGGTCCAAAAGG - Intronic
943504653 2:188739316-188739338 GATTTATCCCAGGGATTCAAAGG + Intronic
943828138 2:192422434-192422456 TTTTTGTTCCAGGGAATTAATGG + Intergenic
946536230 2:220632335-220632357 CTTTTGTTTCAGGGACTGAATGG - Intergenic
948622302 2:239244044-239244066 GGTTTGTCCCAGGGCCTCACTGG + Intronic
1172336956 20:34124704-34124726 ATTTTGTCCCAGGGGCTGCTAGG - Intergenic
1176482285 21:7312516-7312538 TTTTTCTCCCTAGGACTCAAAGG - Intergenic
1177560001 21:22738488-22738510 TTTCTGTCCCAGGAACACAAGGG + Intergenic
1182043614 22:27257514-27257536 ATTTTTTCCCAGGGGCCCTATGG + Intergenic
1183687478 22:39369506-39369528 ATTTACTCCCAGAGACCCAAGGG - Intronic
1183874673 22:40769449-40769471 ATTTTGTCATAGGGACAAAAAGG + Intergenic
1183976860 22:41517357-41517379 GTTTTTACCCAGGGCCTCAAGGG + Intronic
1184950906 22:47842087-47842109 TTTGTGTCCCAGGGCCCCAAGGG + Intergenic
951090948 3:18573504-18573526 ATTTTTTCCCAAGGAGTCACAGG + Intergenic
952120607 3:30239135-30239157 ATCGTGTCCCAGGGTCTCATAGG + Intergenic
953201690 3:40783499-40783521 AATTTGTCTAAGGAACTCAATGG - Intergenic
954767130 3:52928824-52928846 CTGTTGTCCCAGCTACTCAAGGG - Intronic
955945477 3:64189627-64189649 ATTTTGTACCAAGGATTAAATGG + Intronic
955974702 3:64468738-64468760 ATTATTTCCCAGGGACCCAGGGG - Intergenic
956123008 3:65984875-65984897 ATTTTGTACCATGGAGACAAGGG + Intronic
958175069 3:89987358-89987380 GATTTATCCCAGGGACACAAGGG + Intergenic
958757409 3:98266927-98266949 GATTTGTCCCAGGGATGCAAAGG - Intergenic
959006733 3:101028010-101028032 AGTTTATCCCAGGAATTCAAGGG + Intergenic
963446900 3:145423554-145423576 ATTTGGGCCCAGTGACTAAAGGG - Intergenic
965032827 3:163395364-163395386 GTTTTATACCAGGGACGCAAGGG + Intergenic
965322880 3:167269275-167269297 CTTTTATCCCAGAGACTCAAAGG - Intronic
971012777 4:22457075-22457097 ATTGTTTCCCAGAGAATCAATGG - Intronic
973969996 4:56203909-56203931 GTTTTGTCCCAGGGATTAGAAGG - Intronic
977996667 4:103503425-103503447 ATGTTGTCGGAGGGACTCAGGGG + Intergenic
978159154 4:105526171-105526193 TTTTCCTACCAGGGACTCAAAGG - Intergenic
981392251 4:144204867-144204889 AGTTTGGGCCAGGGAGTCAAGGG - Intergenic
982460411 4:155663179-155663201 TTTCTGTCCCAGAGACTCTAAGG + Intergenic
982665236 4:158252932-158252954 AATATTTCCCAGGGACTGAAAGG - Intronic
983323066 4:166218913-166218935 ATTTTGACCAAGGGACTGATAGG + Intergenic
985144558 4:186881528-186881550 GTTATGTCCCAAGGAGTCAAGGG - Intergenic
986000139 5:3624068-3624090 ATTTTGATCCAAGCACTCAAAGG + Intergenic
987219337 5:15773522-15773544 ATATGGTCCCAGCTACTCAAGGG + Intronic
988408683 5:30857607-30857629 ACTTTGTCCCAGGCACTGTAAGG + Intergenic
989444053 5:41508261-41508283 ATTTTGTCCCAGGGCAGGAAAGG + Intronic
991327203 5:65448398-65448420 ATTTTGTCCCAGGGACTCAAAGG - Intronic
991459917 5:66847210-66847232 ATTCTGTCCCAGGGACCACAAGG + Intronic
996347443 5:122502133-122502155 ATGTAGTCCCAGGTACTCAGGGG + Intergenic
996812180 5:127528790-127528812 ATTTTCTTCCAGCTACTCAATGG + Intronic
996973897 5:129407744-129407766 ATTTTGTGGAAGGGACTCAGTGG + Intergenic
1000682883 5:164208341-164208363 ACTTTGTTCCAGGCACACAAAGG + Intergenic
1001868718 5:175131361-175131383 ATCTTGTGGCAGGGCCTCAAGGG - Intergenic
1006263681 6:32897342-32897364 ATTTTTCACCAGTGACTCAATGG + Intergenic
1006597623 6:35205000-35205022 ACTATGTACCAGGGACTTAAAGG - Intergenic
1007083977 6:39129813-39129835 ATCTTGGCCCAGGGACTTAGTGG - Intergenic
1010079914 6:71848693-71848715 ACTCTGTCCCAGGTAGTCAAGGG + Intergenic
1010823729 6:80447616-80447638 CTTTTGTCCCAAGGAATCCATGG + Intergenic
1012753232 6:103190072-103190094 ATTTTGTCACAGGGGGTTAAGGG - Intergenic
1013437469 6:110125216-110125238 ATTTTTTCTTAGGGACTCACGGG + Intronic
1017376792 6:153779868-153779890 ATTTTCTCCCATAGCCTCAATGG - Intergenic
1018752628 6:166821000-166821022 ATTTTATCACAGGGAGCCAAGGG + Intronic
1021381504 7:19972795-19972817 ATTTTGTCACCGAGACTCCACGG + Intergenic
1023091216 7:36619192-36619214 ACTGTGTCCCAGGGACCCCAGGG - Intronic
1028053324 7:86210869-86210891 ATCTTGTCCCAGTGACTTGAGGG + Intergenic
1035144217 7:156797199-156797221 ATTTTGTGCCAGGGAGGAAAAGG - Intronic
1035161187 7:156950936-156950958 TTTTTATCCCGGGGACTTAAGGG + Intronic
1035192685 7:157185513-157185535 ATTTTGAGCCAGGCACTCATAGG + Intronic
1040126022 8:43738900-43738922 TTTTTCTCCCCAGGACTCAATGG - Intergenic
1042322704 8:67494734-67494756 AATTTGTACCAGGACCTCAATGG + Intronic
1046996521 8:120530151-120530173 ATTTACTCCCAAGAACTCAAAGG - Intronic
1047231004 8:122997708-122997730 CTTTTGCACCAGGGACTCAATGG - Intergenic
1048825044 8:138416140-138416162 ATTTTGTCCTGGGGGATCAAGGG - Intronic
1050317263 9:4415209-4415231 ACTTTGTCTGAGGGAGTCAATGG - Intergenic
1051818943 9:21142312-21142334 CTGTTGTCCCAGGTACTCAGGGG - Intergenic
1052488427 9:29131921-29131943 TTTTTGTACCAGGGAATCAAAGG - Intergenic
1053182060 9:35981067-35981089 ATTCCATCCCAGGGACTAAACGG + Intergenic
1055288458 9:74756724-74756746 CTGTGGTCCCAGGTACTCAAGGG + Intronic
1056651105 9:88463595-88463617 GTTATATCCCAGGGACACAATGG - Intronic
1057207610 9:93183155-93183177 ATTTTGTGCCAGGGGCTCCAAGG + Intergenic
1057412735 9:94831960-94831982 ATATTCTCCAAGGGACTGAAGGG + Intronic
1057714906 9:97484993-97485015 AATTTGTCCCAGATAATCAAGGG + Intronic
1059803158 9:117771490-117771512 TTTTTTTCCCTTGGACTCAAGGG + Intergenic
1061132927 9:128718392-128718414 CTTTTGTCCCAGGGATGCACGGG + Intronic
1062420478 9:136478709-136478731 CTGTAGTCCCAGGGACTCAGGGG + Intronic
1186353134 X:8760520-8760542 ATTGTGTCCCAGAGACTGCATGG + Intergenic
1196195773 X:112837640-112837662 ATTTTGTCCCAGGAACTAAGGGG - Intronic
1198242766 X:134801494-134801516 ATTATGTCCCAGGGACCCTTTGG + Intronic
1198570880 X:137955447-137955469 AATTTATCCCAGGGATGCAAGGG - Intergenic