ID: 991327990

View in Genome Browser
Species Human (GRCh38)
Location 5:65459198-65459220
Sequence TTAGGAGGATGTTAGTCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 114}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991327990 Original CRISPR TTAGGAGGATGTTAGTCTAA AGG (reversed) Intronic
903448907 1:23439429-23439451 TTAGGAAGATGCCAGTCTGATGG + Intronic
909580601 1:77229365-77229387 TTAGGAAGATATTAGAATAATGG + Intergenic
911245764 1:95515397-95515419 TTAGAAAGATGTTGGTCAAAGGG - Intergenic
915068560 1:153246341-153246363 TTAGGAGGATGTTATTTCATTGG - Intergenic
917264822 1:173209911-173209933 TTAGGAGGTTAATAGTCTATGGG - Intergenic
917683385 1:177391344-177391366 GTAGGGGGATGTTAAGCTAATGG + Intergenic
919121825 1:193350723-193350745 TTGGGTGTATGTTAGTTTAAGGG + Intergenic
921782537 1:219183073-219183095 TCAGGAGGATGTGAGACAAATGG - Intronic
1062872030 10:913210-913232 TTAAGAGACTGATAGTCTAAAGG + Intronic
1071156323 10:82693165-82693187 TTAGCAGGATTTTATACTAAGGG - Intronic
1073784100 10:106869338-106869360 TCAGGATGATGTTAGTCTCATGG - Intronic
1073925253 10:108507787-108507809 TTGGGAGGGTGTTAGTGTCAAGG - Intergenic
1077313117 11:1901532-1901554 TTAGAAGATTGATAGTCTAAAGG - Intergenic
1078821528 11:14887902-14887924 TTAGGAGGTTGTTGTTATAAGGG - Intronic
1080096662 11:28416465-28416487 TGAGGAGTATGTGAGACTAAGGG - Intergenic
1084897473 11:72284239-72284261 TTAAGAGGATGGTGGGCTAATGG + Intergenic
1088062162 11:105667978-105668000 ATGGGAAGATGTTAGTCAAAGGG - Intronic
1088155213 11:106794353-106794375 ATGGGAAGATGTTAGTCAAATGG + Intronic
1090122146 11:124041427-124041449 TTAGGAAGATGTTTATCTACAGG - Intergenic
1091889546 12:4042445-4042467 TTAAGATCATATTAGTCTAATGG + Intergenic
1099652867 12:85451078-85451100 TTAATAGGATGTAAGTTTAATGG - Intergenic
1100916581 12:99430572-99430594 GGTGGAGGATGTTACTCTAATGG - Intronic
1106815119 13:33399340-33399362 TCAGGGAGATGTTAGTCAAAGGG + Intergenic
1107200144 13:37705311-37705333 TGAGGAAGATGTTGGTCAAAGGG + Intronic
1109410035 13:61951496-61951518 TTATAAGGATGAAAGTCTAATGG + Intergenic
1110253834 13:73409914-73409936 GAGGGATGATGTTAGTCTAAAGG + Intergenic
1115063813 14:29228721-29228743 TTAGAAGAATCTTAGTCTAAGGG + Intergenic
1115366918 14:32568486-32568508 TTAGGATTATGATAGTTTAATGG - Intronic
1119617199 14:76106741-76106763 TTATGAGGATGGTATTCTACTGG - Intergenic
1121804062 14:96798503-96798525 TTGGGAGGATGTTGGTTTTAGGG + Intronic
1123926567 15:25118330-25118352 TGAGGAGGCTTTTTGTCTAAGGG - Intergenic
1125107120 15:35985302-35985324 TGGGGGTGATGTTAGTCTAATGG - Intergenic
1125384744 15:39125283-39125305 TTAGGAGAATGCTAGGCAAATGG - Intergenic
1131960523 15:97785715-97785737 TTAAGGGGATGTTAGTGTTATGG + Intergenic
1137659654 16:50193652-50193674 TTAAGAGGAGGTTTGTCTGATGG + Intronic
1139090582 16:63641863-63641885 TTGGGTGGATGTTAATCTGAAGG + Intergenic
1141969919 16:87474259-87474281 TTTGGAGGATGTCAGTGGAATGG - Intronic
1143668606 17:8380825-8380847 TTGGGAGGAACTTAGTCTACAGG + Intronic
1160472614 18:79150986-79151008 TTAGAAGTATGTTATTCAAAAGG + Intronic
1162230019 19:9258958-9258980 CTAGGAGGATGTTACTCCTAAGG + Intergenic
1167262744 19:48468211-48468233 TTAGGAGGATGCTAAGCTAAAGG + Intronic
927216854 2:20672304-20672326 TCAGGAGGAAGTTAGTGCAATGG + Exonic
928696062 2:33851454-33851476 TTAGAAGGATGTTCTTCTGATGG - Intergenic
931858238 2:66326631-66326653 TTGGGAAGATGTTAGTCAAAGGG + Intergenic
933008417 2:77024363-77024385 TTTGGAGGATATTATGCTAAAGG - Intronic
933934557 2:87191515-87191537 TTGTGAGGATGTCAGTCTACTGG - Intergenic
936358586 2:111774381-111774403 TTGTGAGGATGTCAGTCTACTGG + Intronic
938424395 2:131172529-131172551 GTGGGAAGTTGTTAGTCTAAGGG - Intronic
939601075 2:144190762-144190784 TTAGGAGGGTATGATTCTAAGGG + Intronic
939878633 2:147605259-147605281 TTGGGAGGAGTTTAGTCAAATGG - Intergenic
942939727 2:181601951-181601973 TTCAGAGGATGGTAGACTAAAGG + Intronic
946103564 2:217349871-217349893 TTCTGAGGCTGTTAGTCTGATGG + Intronic
946272626 2:218607031-218607053 TTAGGAGGATTTTATTTTAATGG + Intergenic
1173669861 20:44791334-44791356 TTATGAGGATGTTAGACTCAAGG + Intronic
1177188389 21:17822479-17822501 TTGGGAAGATGTTACTCTAGTGG + Intergenic
1177864607 21:26498507-26498529 GTAGGAGGGTGTTTGACTAATGG + Intronic
1178197507 21:30364622-30364644 TTGGGAGGGTGTTGGTCAAAGGG + Intronic
1178228231 21:30749950-30749972 ATGGGAAGATGTTAGTTTAAGGG - Intergenic
1182512777 22:30830849-30830871 TTAAAAGGATGTTTGTATAAAGG - Intronic
949721159 3:6991907-6991929 ATAGGGAGATGTTAGTCAAAGGG - Intronic
949863213 3:8525172-8525194 ATGGGAGGATGTTGGTCAAAGGG - Intronic
950607685 3:14097551-14097573 TTGGGGAGATGTTAGTCAAAGGG - Intergenic
957442251 3:80264628-80264650 TTAGGAGGATGTATGTCTCCAGG + Intergenic
959198603 3:103217294-103217316 TTAGAAAGATGTTTTTCTAATGG - Intergenic
960243040 3:115367817-115367839 TTAGGAGGATGTAGGTTAAAGGG + Intergenic
961351836 3:126309012-126309034 TGAGGAGGATGTGAGTCTTATGG - Intergenic
965005951 3:163023831-163023853 TCAGAAGGATGTCAGTCTAAAGG - Intergenic
965846073 3:172963062-172963084 TTATGATGATTTTAGTATAATGG + Intronic
966450492 3:180054106-180054128 TTAGCAGAATGATATTCTAAAGG + Intergenic
974205702 4:58700541-58700563 TTATGAGGACATTAGTCTTAAGG + Intergenic
975222302 4:71826859-71826881 TTAGGATGAAGTTAAGCTAATGG + Intergenic
975756661 4:77578244-77578266 TTTGGAGTTTGATAGTCTAAAGG - Intronic
977374051 4:96177886-96177908 TTGGGAAGATGTTGGTCAAAGGG + Intergenic
978534519 4:109746947-109746969 TTAGGATAAAGTTAGTCTTAAGG - Intronic
981348938 4:143706350-143706372 TTTGGAAGATGTTAGTCAAAGGG + Intergenic
982509480 4:156263476-156263498 TTAGGAAGTTGTTACTTTAATGG - Intergenic
982608227 4:157540080-157540102 TCAGCAGGATGCTAGTCTACTGG + Intergenic
983263993 4:165487940-165487962 TAAGGAGGATTTTAATCTTAGGG + Intronic
984132105 4:175890416-175890438 TTAGGAGGCTTTTTGTATAATGG + Intronic
986788416 5:11137270-11137292 TTGGGAGCATGTTGATCTAAAGG + Intronic
987201088 5:15579107-15579129 TTAGGAACCTGTAAGTCTAAAGG - Intronic
987747062 5:21988701-21988723 TGAGGAGTTTGTCAGTCTAAAGG + Intronic
991243712 5:64487438-64487460 TTGGGAAGATGTTGGTCAAAGGG - Intergenic
991327990 5:65459198-65459220 TTAGGAGGATGTTAGTCTAAAGG - Intronic
991767237 5:69998465-69998487 TGAGGAGTTTGTCAGTCTAAAGG + Intergenic
991846471 5:70873543-70873565 TGAGGAGTTTGTCAGTCTAAAGG + Intergenic
993818708 5:92586493-92586515 TTATGAGGATTATATTCTAATGG + Intergenic
994141440 5:96346093-96346115 ATCGGAGGATGTTAGCCTACTGG - Intergenic
994340553 5:98622483-98622505 TAAGGAGGATGTCCATCTAAGGG - Intergenic
994772429 5:103999988-104000010 TTATCAGGATTTGAGTCTAAGGG + Intergenic
996241006 5:121201403-121201425 TTAGGAAGAGGCTAGTTTAAAGG - Intergenic
1004742351 6:18474310-18474332 TTATGAGTGTGTTAGTCTAAGGG + Intergenic
1004773091 6:18809021-18809043 ATAGGAAGATGTTGGTCGAAGGG + Intergenic
1005027348 6:21476093-21476115 TTAGGGAGATGTTTGTCAAACGG + Intergenic
1007938950 6:45758879-45758901 TTAGGAGGATGTTAATTGACAGG - Intergenic
1010201055 6:73282458-73282480 TTAGGAGGAACTTAGTTTATAGG + Intronic
1011287058 6:85736083-85736105 TTAAGAGGATGTAAATCCAATGG + Intergenic
1013926382 6:115477764-115477786 TTGGGAGGGTGTAAGTGTAAAGG + Intergenic
1014683924 6:124470740-124470762 TTAGGATAATATTAGACTAATGG + Intronic
1015301729 6:131660217-131660239 TTAGGATTATGTTAGTCTTGAGG + Intronic
1015866934 6:137736617-137736639 TTAAGAGCATGTTAGTCATAGGG + Intergenic
1016182372 6:141162948-141162970 ATGGGAAGATGTTAGTCAAAGGG - Intergenic
1019151448 6:170008665-170008687 TTAGGTGGAGGTGAGTTTAACGG - Intergenic
1024763608 7:52629872-52629894 TCATGAGGCTCTTAGTCTAATGG - Intergenic
1028002317 7:85514831-85514853 TGAGGAGGAAGTTAGTCTAGGGG - Intergenic
1032113853 7:129100510-129100532 TAAGGATGATGTTACTCTATAGG - Intergenic
1034719358 7:153274973-153274995 TTAGGAGGATGTTGAGCAAACGG + Intergenic
1036076655 8:5509491-5509513 ATTTGAGGATGTTAGTCTCATGG - Intergenic
1038154827 8:24979450-24979472 TAAGGAGATTGTTCGTCTAAAGG + Intergenic
1041468830 8:58186087-58186109 ATAGGAAGATGTAACTCTAATGG + Intronic
1041784906 8:61621001-61621023 CTGGGAGGACGTGAGTCTAAAGG - Intronic
1048041441 8:130732640-130732662 TTATGAGGAGGTTAGTCTTCGGG + Intergenic
1051776105 9:20635881-20635903 GTAGGAGGCTTTTAGTCAAAAGG + Intergenic
1052005905 9:23348130-23348152 TTAGGAAGATATTGGTCAAAAGG + Intergenic
1058576452 9:106408604-106408626 TTATGGGATTGTTAGTCTAATGG - Intergenic
1060020731 9:120128411-120128433 TTGGGAAGATGTTAGTCAAAGGG + Intergenic
1060670655 9:125466608-125466630 TTAGGAAGATGTTTATCCAAAGG + Intronic
1062516438 9:136939310-136939332 TTCTGAGGGTGTTAGTCTCAGGG + Intronic
1188179227 X:27033537-27033559 TGAGGAGGCTTTTTGTCTAAGGG + Intergenic
1188376335 X:29433252-29433274 CTGGAAGGATGTTTGTCTAAAGG - Intronic
1188882134 X:35501852-35501874 TGATGAGGATGTTAGGCTGAAGG - Intergenic
1189823895 X:44898039-44898061 TTAGGAAGATGTGAGGGTAAGGG - Intronic
1192601050 X:72464546-72464568 TTGGGAGGAGGTGAGTATAAAGG - Exonic
1193726645 X:85048312-85048334 TTAGGAGGATGTTGATTTTAAGG + Intronic
1194473707 X:94332805-94332827 TTTGGAGGATGTTAATTTGATGG - Intergenic
1194825469 X:98557242-98557264 TTAGGAAGCTGTTAATCTCATGG - Intergenic
1195831384 X:109063031-109063053 TCAGGATGATGTTGGTCTCATGG - Intergenic
1196687143 X:118520919-118520941 TTATGTGGATGTCAGTCTAAAGG - Intronic